Incidental Mutation 'R3692:Ifi208'
ID268806
Institutional Source Beutler Lab
Gene Symbol Ifi208
Ensembl Gene ENSMUSG00000066677
Gene Nameinterferon activated gene 208
SynonymsPydc3, E430029J22Rik, Pyr-rv1
MMRRC Submission 040687-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3692 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location173673675-173698395 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 173682872 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 198 (S198P)
Ref Sequence ENSEMBL: ENSMUSP00000128958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085876] [ENSMUST00000169857]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085876
AA Change: S198P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000083039
Gene: ENSMUSG00000066677
AA Change: S198P

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
low complexity region 488 504 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169857
AA Change: S198P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128958
Gene: ENSMUSG00000066677
AA Change: S198P

DomainStartEndE-ValueType
PYRIN 10 88 3.23e-20 SMART
low complexity region 101 112 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:HERV-K_REC 502 580 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182880
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,269,509 D598G probably damaging Het
Adam1a T C 5: 121,519,322 D636G probably damaging Het
Adgrv1 A G 13: 81,524,600 V2218A possibly damaging Het
Ano5 T A 7: 51,590,579 Y752N probably damaging Het
Calca T C 7: 114,634,561 E45G probably damaging Het
Cdk8 C T 5: 146,283,668 R166* probably null Het
Chsy1 T A 7: 66,171,253 M412K probably damaging Het
Cic T A 7: 25,288,913 Y1675* probably null Het
Col1a2 T A 6: 4,510,710 D53E possibly damaging Het
Dennd6b A G 15: 89,186,827 probably benign Het
Fut10 T A 8: 31,236,020 Y268N possibly damaging Het
Glrx3 T C 7: 137,459,117 probably benign Het
Gucy1b2 T A 14: 62,404,627 N697I probably damaging Het
Krt34 A G 11: 100,039,031 V213A probably damaging Het
Lats2 T C 14: 57,691,541 N959S probably damaging Het
Mat1a A G 14: 41,121,381 Y288C probably damaging Het
Mtif2 A T 11: 29,540,718 H474L probably benign Het
Myh8 A G 11: 67,301,918 I1512V probably damaging Het
Nkx2-6 T C 14: 69,172,027 S76P probably benign Het
Noxred1 G A 12: 87,233,466 R31W probably benign Het
Olfr1241 T A 2: 89,482,896 M80L probably benign Het
Olfr310 T A 7: 86,269,495 Q98L probably damaging Het
Pcdhb16 C A 18: 37,478,287 T100K probably benign Het
Pcdhga10 T C 18: 37,748,331 C382R probably damaging Het
Pdgfra A T 5: 75,189,287 Y944F possibly damaging Het
Pkhd1 A G 1: 20,555,129 I741T possibly damaging Het
Ppp1r10 A G 17: 35,930,868 D845G unknown Het
Rfk C A 19: 17,399,470 probably null Het
Rgs11 C T 17: 26,204,328 probably benign Het
Spata31d1b T C 13: 59,717,891 V951A probably benign Het
St3gal5 T C 6: 72,149,029 V286A probably benign Het
St7l T C 3: 104,891,554 M320T probably benign Het
Tnfrsf1b G T 4: 145,227,522 Q86K probably benign Het
Tox T C 4: 6,697,535 I423V probably benign Het
Tpbpa T A 13: 60,940,013 H88L probably benign Het
Vmn1r236 A G 17: 21,286,806 Y62C probably benign Het
Ythdc1 A G 5: 86,822,667 I399M probably damaging Het
Zfp948 T G 17: 21,587,576 D343E probably benign Het
Zswim6 A G 13: 107,726,541 noncoding transcript Het
Other mutations in Ifi208
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Ifi208 APN 1 173679038 critical splice donor site probably null
IGL00725:Ifi208 APN 1 173682861 missense possibly damaging 0.86
IGL01952:Ifi208 APN 1 173679031 missense possibly damaging 0.93
IGL02024:Ifi208 APN 1 173683290 missense probably damaging 0.99
IGL02637:Ifi208 APN 1 173678942 missense probably benign 0.15
IGL02829:Ifi208 APN 1 173682840 missense probably damaging 0.99
IGL03216:Ifi208 APN 1 173678941 missense possibly damaging 0.68
IGL03398:Ifi208 APN 1 173683251 missense probably damaging 0.96
FR4304:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4340:Ifi208 UTSW 1 173677698 small deletion probably benign
FR4342:Ifi208 UTSW 1 173677698 small deletion probably benign
R0022:Ifi208 UTSW 1 173683046 missense possibly damaging 0.91
R0468:Ifi208 UTSW 1 173683481 missense probably benign 0.08
R0734:Ifi208 UTSW 1 173683335 missense probably damaging 0.98
R0780:Ifi208 UTSW 1 173682696 missense probably benign 0.06
R1070:Ifi208 UTSW 1 173683044 missense probably damaging 0.99
R1339:Ifi208 UTSW 1 173683238 missense probably damaging 0.99
R1473:Ifi208 UTSW 1 173695654 missense possibly damaging 0.53
R1755:Ifi208 UTSW 1 173677910 missense possibly damaging 0.86
R3012:Ifi208 UTSW 1 173695570 critical splice acceptor site probably null
R4175:Ifi208 UTSW 1 173682701 missense probably benign 0.01
R4235:Ifi208 UTSW 1 173682911 missense probably benign 0.06
R4749:Ifi208 UTSW 1 173695614 missense possibly damaging 0.70
R4815:Ifi208 UTSW 1 173682837 missense probably damaging 0.96
R5116:Ifi208 UTSW 1 173677983 intron probably benign
R5138:Ifi208 UTSW 1 173690673 missense probably null 0.29
R5210:Ifi208 UTSW 1 173683265 missense probably benign
R5304:Ifi208 UTSW 1 173683608 missense probably benign
R6126:Ifi208 UTSW 1 173677708 missense possibly damaging 0.91
R6558:Ifi208 UTSW 1 173683023 missense probably damaging 0.99
R6915:Ifi208 UTSW 1 173682878 missense probably damaging 1.00
R7513:Ifi208 UTSW 1 173695654 nonsense probably null
R7972:Ifi208 UTSW 1 173678990 missense possibly damaging 0.68
R8143:Ifi208 UTSW 1 173682676 missense possibly damaging 0.91
R8383:Ifi208 UTSW 1 173683509 missense possibly damaging 0.93
R8431:Ifi208 UTSW 1 173683278 missense possibly damaging 0.85
RF027:Ifi208 UTSW 1 173677696 small deletion probably benign
RF029:Ifi208 UTSW 1 173677696 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- TTCAGGAAAGCAAAGATACTATCCC -3'
(R):5'- CTTGAGTCATCTGAGTGGCC -3'

Sequencing Primer
(F):5'- TATCCCTGAATCACCTGATACCATG -3'
(R):5'- AGTCATCTGAGTGGCCTGGAC -3'
Posted On2015-02-19