Incidental Mutation 'R3692:Olfr310'
ID268820
Institutional Source Beutler Lab
Gene Symbol Olfr310
Ensembl Gene ENSMUSG00000057540
Gene Nameolfactory receptor 310
SynonymsGA_x6K02T2NHDJ-9838699-9839697, MOR227-6P
MMRRC Submission 040687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3692 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86268487-86277172 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86269495 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 98 (Q98L)
Ref Sequence ENSEMBL: ENSMUSP00000151989 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081918] [ENSMUST00000217724]
Predicted Effect probably damaging
Transcript: ENSMUST00000081918
AA Change: Q98L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080589
Gene: ENSMUSG00000057540
AA Change: Q98L

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 8.9e-46 PFAM
Pfam:7tm_1 39 289 1.8e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217724
AA Change: Q98L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3345 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,269,509 D598G probably damaging Het
Adam1a T C 5: 121,519,322 D636G probably damaging Het
Adgrv1 A G 13: 81,524,600 V2218A possibly damaging Het
Ano5 T A 7: 51,590,579 Y752N probably damaging Het
Calca T C 7: 114,634,561 E45G probably damaging Het
Cdk8 C T 5: 146,283,668 R166* probably null Het
Chsy1 T A 7: 66,171,253 M412K probably damaging Het
Cic T A 7: 25,288,913 Y1675* probably null Het
Col1a2 T A 6: 4,510,710 D53E possibly damaging Het
Dennd6b A G 15: 89,186,827 probably benign Het
Fut10 T A 8: 31,236,020 Y268N possibly damaging Het
Glrx3 T C 7: 137,459,117 probably benign Het
Gucy1b2 T A 14: 62,404,627 N697I probably damaging Het
Ifi208 T C 1: 173,682,872 S198P possibly damaging Het
Krt34 A G 11: 100,039,031 V213A probably damaging Het
Lats2 T C 14: 57,691,541 N959S probably damaging Het
Mat1a A G 14: 41,121,381 Y288C probably damaging Het
Mtif2 A T 11: 29,540,718 H474L probably benign Het
Myh8 A G 11: 67,301,918 I1512V probably damaging Het
Nkx2-6 T C 14: 69,172,027 S76P probably benign Het
Noxred1 G A 12: 87,233,466 R31W probably benign Het
Olfr1241 T A 2: 89,482,896 M80L probably benign Het
Pcdhb16 C A 18: 37,478,287 T100K probably benign Het
Pcdhga10 T C 18: 37,748,331 C382R probably damaging Het
Pdgfra A T 5: 75,189,287 Y944F possibly damaging Het
Pkhd1 A G 1: 20,555,129 I741T possibly damaging Het
Ppp1r10 A G 17: 35,930,868 D845G unknown Het
Rfk C A 19: 17,399,470 probably null Het
Rgs11 C T 17: 26,204,328 probably benign Het
Spata31d1b T C 13: 59,717,891 V951A probably benign Het
St3gal5 T C 6: 72,149,029 V286A probably benign Het
St7l T C 3: 104,891,554 M320T probably benign Het
Tnfrsf1b G T 4: 145,227,522 Q86K probably benign Het
Tox T C 4: 6,697,535 I423V probably benign Het
Tpbpa T A 13: 60,940,013 H88L probably benign Het
Vmn1r236 A G 17: 21,286,806 Y62C probably benign Het
Ythdc1 A G 5: 86,822,667 I399M probably damaging Het
Zfp948 T G 17: 21,587,576 D343E probably benign Het
Zswim6 A G 13: 107,726,541 noncoding transcript Het
Other mutations in Olfr310
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Olfr310 APN 7 86269669 missense probably damaging 1.00
IGL00917:Olfr310 APN 7 86269441 missense probably damaging 1.00
IGL02145:Olfr310 APN 7 86269258 missense probably damaging 1.00
IGL02639:Olfr310 APN 7 86269720 missense probably damaging 0.99
R0139:Olfr310 UTSW 7 86268979 missense probably benign 0.00
R0554:Olfr310 UTSW 7 86269657 missense probably damaging 0.99
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1392:Olfr310 UTSW 7 86268855 missense probably benign 0.01
R1474:Olfr310 UTSW 7 86269062 missense probably damaging 1.00
R2379:Olfr310 UTSW 7 86269649 missense probably damaging 1.00
R4290:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4291:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R4295:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R5071:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5072:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5074:Olfr310 UTSW 7 86269591 missense probably damaging 0.99
R5828:Olfr310 UTSW 7 86269520 missense probably benign 0.00
R6174:Olfr310 UTSW 7 86268801 missense probably benign
R6207:Olfr310 UTSW 7 86269760 missense probably damaging 1.00
R6493:Olfr310 UTSW 7 86268882 missense probably benign 0.21
R7068:Olfr310 UTSW 7 86269537 missense probably damaging 1.00
R7196:Olfr310 UTSW 7 86269441 missense probably damaging 1.00
R7694:Olfr310 UTSW 7 86269775 missense probably damaging 1.00
R7794:Olfr310 UTSW 7 86269133 missense probably damaging 0.99
Z1176:Olfr310 UTSW 7 86268947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCAATGACAAGGGAGCTG -3'
(R):5'- GCTCAGGATCTTAATCACTGTGC -3'

Sequencing Primer
(F):5'- CTGAGTAGGGAAGCCAGTGTCATC -3'
(R):5'- ATCTGTGCAGCCTGTTAGGGAAC -3'
Posted On2015-02-19