Incidental Mutation 'R3692:Dennd6b'
ID268838
Institutional Source Beutler Lab
Gene Symbol Dennd6b
Ensembl Gene ENSMUSG00000015377
Gene NameDENN/MADD domain containing 6B
SynonymsFam116b, 1700027J05Rik
MMRRC Submission 040687-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R3692 (G1)
Quality Score212
Status Validated
Chromosome15
Chromosomal Location89182213-89196496 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 89186827 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078953] [ENSMUST00000229755]
Predicted Effect probably benign
Transcript: ENSMUST00000078953
SMART Domains Protein: ENSMUSP00000077978
Gene: ENSMUSG00000015377

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Avl9 42 181 1.1e-8 PFAM
Pfam:DENN 148 344 1.2e-8 PFAM
Pfam:SPA 248 358 6.7e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184207
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229416
Predicted Effect probably benign
Transcript: ENSMUST00000229755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230823
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik A G 11: 78,269,509 D598G probably damaging Het
Adam1a T C 5: 121,519,322 D636G probably damaging Het
Adgrv1 A G 13: 81,524,600 V2218A possibly damaging Het
Ano5 T A 7: 51,590,579 Y752N probably damaging Het
Calca T C 7: 114,634,561 E45G probably damaging Het
Cdk8 C T 5: 146,283,668 R166* probably null Het
Chsy1 T A 7: 66,171,253 M412K probably damaging Het
Cic T A 7: 25,288,913 Y1675* probably null Het
Col1a2 T A 6: 4,510,710 D53E possibly damaging Het
Fut10 T A 8: 31,236,020 Y268N possibly damaging Het
Glrx3 T C 7: 137,459,117 probably benign Het
Gucy1b2 T A 14: 62,404,627 N697I probably damaging Het
Ifi208 T C 1: 173,682,872 S198P possibly damaging Het
Krt34 A G 11: 100,039,031 V213A probably damaging Het
Lats2 T C 14: 57,691,541 N959S probably damaging Het
Mat1a A G 14: 41,121,381 Y288C probably damaging Het
Mtif2 A T 11: 29,540,718 H474L probably benign Het
Myh8 A G 11: 67,301,918 I1512V probably damaging Het
Nkx2-6 T C 14: 69,172,027 S76P probably benign Het
Noxred1 G A 12: 87,233,466 R31W probably benign Het
Olfr1241 T A 2: 89,482,896 M80L probably benign Het
Olfr310 T A 7: 86,269,495 Q98L probably damaging Het
Pcdhb16 C A 18: 37,478,287 T100K probably benign Het
Pcdhga10 T C 18: 37,748,331 C382R probably damaging Het
Pdgfra A T 5: 75,189,287 Y944F possibly damaging Het
Pkhd1 A G 1: 20,555,129 I741T possibly damaging Het
Ppp1r10 A G 17: 35,930,868 D845G unknown Het
Rfk C A 19: 17,399,470 probably null Het
Rgs11 C T 17: 26,204,328 probably benign Het
Spata31d1b T C 13: 59,717,891 V951A probably benign Het
St3gal5 T C 6: 72,149,029 V286A probably benign Het
St7l T C 3: 104,891,554 M320T probably benign Het
Tnfrsf1b G T 4: 145,227,522 Q86K probably benign Het
Tox T C 4: 6,697,535 I423V probably benign Het
Tpbpa T A 13: 60,940,013 H88L probably benign Het
Vmn1r236 A G 17: 21,286,806 Y62C probably benign Het
Ythdc1 A G 5: 86,822,667 I399M probably damaging Het
Zfp948 T G 17: 21,587,576 D343E probably benign Het
Zswim6 A G 13: 107,726,541 noncoding transcript Het
Other mutations in Dennd6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02709:Dennd6b APN 15 89190922 splice site probably benign
IGL03109:Dennd6b APN 15 89184985 utr 3 prime probably benign
IGL03133:Dennd6b APN 15 89188523 critical splice acceptor site probably null
P0016:Dennd6b UTSW 15 89186977 missense probably benign
PIT4791001:Dennd6b UTSW 15 89186752 critical splice donor site probably null
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0025:Dennd6b UTSW 15 89186183 missense probably benign 0.11
R0268:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0344:Dennd6b UTSW 15 89196229 missense probably benign 0.01
R0391:Dennd6b UTSW 15 89187214 missense probably damaging 1.00
R1453:Dennd6b UTSW 15 89188872 missense probably damaging 0.99
R1655:Dennd6b UTSW 15 89196340 missense unknown
R1670:Dennd6b UTSW 15 89185337 intron probably benign
R1765:Dennd6b UTSW 15 89190303 nonsense probably null
R1968:Dennd6b UTSW 15 89190341 missense possibly damaging 0.63
R4344:Dennd6b UTSW 15 89188663 missense probably benign 0.00
R4736:Dennd6b UTSW 15 89185592 missense probably benign 0.00
R5030:Dennd6b UTSW 15 89196251 missense possibly damaging 0.82
R5058:Dennd6b UTSW 15 89187350 missense possibly damaging 0.69
R5509:Dennd6b UTSW 15 89185022 missense probably damaging 1.00
R6005:Dennd6b UTSW 15 89188168 missense possibly damaging 0.91
R6160:Dennd6b UTSW 15 89188821 missense probably damaging 0.97
R6535:Dennd6b UTSW 15 89186367 missense probably damaging 1.00
R6646:Dennd6b UTSW 15 89186184 missense probably damaging 0.99
R7098:Dennd6b UTSW 15 89188687 missense probably damaging 1.00
R7169:Dennd6b UTSW 15 89188852 missense possibly damaging 0.80
R7381:Dennd6b UTSW 15 89186173 missense possibly damaging 0.84
R7706:Dennd6b UTSW 15 89185244 missense probably benign 0.19
R8070:Dennd6b UTSW 15 89185373 missense probably benign 0.29
X0063:Dennd6b UTSW 15 89185420 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCATGGGGCCTCAATAGAAAG -3'
(R):5'- GGGAGTCACAAACCCTTTCTTTATC -3'

Sequencing Primer
(F):5'- GGCCTCAATAGAAAGAAAAAGAGTC -3'
(R):5'- TTCTTTATCAAAACACTCCAGCACTG -3'
Posted On2015-02-19