Incidental Mutation 'R3693:Eya1'
ID268847
Institutional Source Beutler Lab
Gene Symbol Eya1
Ensembl Gene ENSMUSG00000025932
Gene NameEYA transcriptional coactivator and phosphatase 1
Synonymsbor
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.904) question?
Stock #R3693 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location14168954-14310235 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14229501 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 343 (Y343H)
Ref Sequence ENSEMBL: ENSMUSP00000126383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027066] [ENSMUST00000080664] [ENSMUST00000168081] [ENSMUST00000190337]
Predicted Effect probably damaging
Transcript: ENSMUST00000027066
AA Change: Y347H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027066
Gene: ENSMUSG00000025932
AA Change: Y347H

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000080664
AA Change: Y314H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079493
Gene: ENSMUSG00000025932
AA Change: Y314H

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 201 213 N/A INTRINSIC
low complexity region 256 280 N/A INTRINSIC
PDB:3HB1|D 281 552 1e-173 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000168081
AA Change: Y343H

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126383
Gene: ENSMUSG00000025932
AA Change: Y343H

DomainStartEndE-ValueType
low complexity region 23 42 N/A INTRINSIC
low complexity region 207 219 N/A INTRINSIC
low complexity region 262 286 N/A INTRINSIC
PDB:3HB1|D 287 558 1e-172 PDB
Predicted Effect unknown
Transcript: ENSMUST00000189526
AA Change: Y52H
Predicted Effect probably damaging
Transcript: ENSMUST00000190337
AA Change: Y347H

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141112
Gene: ENSMUSG00000025932
AA Change: Y347H

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 56 75 N/A INTRINSIC
low complexity region 240 252 N/A INTRINSIC
low complexity region 295 319 N/A INTRINSIC
PDB:3HB1|D 320 591 1e-172 PDB
Meta Mutation Damage Score 0.4274 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the eyes absent (EYA) family of proteins. The encoded protein may play a role in the developing kidney, branchial arches, eye, and ear. Mutations of this gene have been associated with branchiootorenal dysplasia syndrome, branchiootic syndrome, and sporadic cases of congenital cataracts and ocular anterior segment anomalies. A similar protein in mice can act as a transcriptional activator. Alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mutations in this locus affect inner ear morphology and hearing, and result in dysmorphic or absent kidneys. Hypomorphs are deaf and circle. Null homozygotes additionally show agenesis of thymus and parathyroid and thyroid hypoplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Ces2e A G 8: 104,928,811 D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Nop14 T C 5: 34,654,438 K202E probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Tas2r143 G A 6: 42,400,976 V247I probably benign Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Eya1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Eya1 APN 1 14270701 splice site probably benign
IGL01110:Eya1 APN 1 14283130 missense probably damaging 1.00
IGL02266:Eya1 APN 1 14184501 missense possibly damaging 0.63
IGL03027:Eya1 APN 1 14170966 missense probably damaging 1.00
IGL03081:Eya1 APN 1 14183191 missense possibly damaging 0.76
IGL03291:Eya1 APN 1 14184348 critical splice donor site probably null
IGL03353:Eya1 APN 1 14179527 missense probably damaging 1.00
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R0042:Eya1 UTSW 1 14184489 missense probably damaging 0.98
R1428:Eya1 UTSW 1 14304414 splice site probably benign
R1521:Eya1 UTSW 1 14274550 missense probably damaging 0.99
R1571:Eya1 UTSW 1 14208917 missense probably damaging 1.00
R1768:Eya1 UTSW 1 14253075 missense possibly damaging 0.95
R1785:Eya1 UTSW 1 14170974 missense probably benign 0.16
R1840:Eya1 UTSW 1 14229504 nonsense probably null
R2114:Eya1 UTSW 1 14270774 missense probably damaging 1.00
R2131:Eya1 UTSW 1 14170974 missense probably benign 0.16
R2212:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R2416:Eya1 UTSW 1 14270703 critical splice donor site probably null
R2424:Eya1 UTSW 1 14270848 splice site probably benign
R3085:Eya1 UTSW 1 14274090 missense probably benign 0.01
R3158:Eya1 UTSW 1 14304467 start gained probably benign
R3412:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3413:Eya1 UTSW 1 14274209 critical splice acceptor site probably null
R3694:Eya1 UTSW 1 14229501 missense probably damaging 1.00
R3899:Eya1 UTSW 1 14270747 missense probably benign 0.04
R4454:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4455:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4456:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4458:Eya1 UTSW 1 14183196 missense probably damaging 0.98
R4761:Eya1 UTSW 1 14302821 missense probably damaging 1.00
R5011:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5013:Eya1 UTSW 1 14184358 missense probably damaging 1.00
R5613:Eya1 UTSW 1 14302929 intron probably benign
R5687:Eya1 UTSW 1 14183252 missense probably damaging 0.99
R6052:Eya1 UTSW 1 14283150 missense probably damaging 1.00
R6181:Eya1 UTSW 1 14302872 missense probably damaging 0.99
R6378:Eya1 UTSW 1 14302803 missense possibly damaging 0.93
R6805:Eya1 UTSW 1 14183277 missense probably benign 0.00
R6863:Eya1 UTSW 1 14270975 intron probably null
R7032:Eya1 UTSW 1 14283200 critical splice acceptor site probably null
R7044:Eya1 UTSW 1 14231410 splice site probably null
R7078:Eya1 UTSW 1 14231412 critical splice donor site probably null
R7179:Eya1 UTSW 1 14302852 missense probably damaging 1.00
R7384:Eya1 UTSW 1 14229512 missense probably damaging 1.00
R7462:Eya1 UTSW 1 14231414 missense probably null 0.99
Z1176:Eya1 UTSW 1 14252430 missense probably benign
Z1176:Eya1 UTSW 1 14302868 missense probably damaging 1.00
Z1177:Eya1 UTSW 1 14184429 missense probably damaging 0.98
Z1177:Eya1 UTSW 1 14253090 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TTCGTGCAGGGAGACAAAGC -3'
(R):5'- ACCTGACAGTTGGGAGATGC -3'

Sequencing Primer
(F):5'- GCATAAGCTGAATGGAATCTGTCTC -3'
(R):5'- TGCCCTTAGGAAAAGCTGAGTG -3'
Posted On2015-02-19