Incidental Mutation 'R3693:Nop14'
ID268852
Institutional Source Beutler Lab
Gene Symbol Nop14
Ensembl Gene ENSMUSG00000036693
Gene NameNOP14 nucleolar protein
SynonymsNol14, 2610033H07Rik
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R3693 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location34638536-34660148 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34654438 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 202 (K202E)
Ref Sequence ENSEMBL: ENSMUSP00000038382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041364]
Predicted Effect probably damaging
Transcript: ENSMUST00000041364
AA Change: K202E

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038382
Gene: ENSMUSG00000036693
AA Change: K202E

DomainStartEndE-ValueType
Pfam:Nop14 21 849 2.2e-273 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134467
Meta Mutation Damage Score 0.4322 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that plays a role in pre-18s rRNA processing and small ribosomal subunit assembly. The encoded protein may be involved in the regulation of pancreatic cancer cell proliferation and migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Ces2e A G 8: 104,928,811 D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Tas2r143 G A 6: 42,400,976 V247I probably benign Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Nop14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Nop14 APN 5 34641313 unclassified probably benign
IGL00985:Nop14 APN 5 34644789 missense probably damaging 0.98
IGL01626:Nop14 APN 5 34649345 nonsense probably null
IGL02676:Nop14 APN 5 34639221 missense probably damaging 0.97
IGL03189:Nop14 APN 5 34650628 unclassified probably benign
IGL03047:Nop14 UTSW 5 34660014 missense possibly damaging 0.93
R0025:Nop14 UTSW 5 34643953 missense probably benign 0.08
R0831:Nop14 UTSW 5 34650520 missense possibly damaging 0.70
R1027:Nop14 UTSW 5 34644004 missense probably damaging 0.99
R1252:Nop14 UTSW 5 34650555 missense probably benign
R1616:Nop14 UTSW 5 34650413 missense possibly damaging 0.46
R1845:Nop14 UTSW 5 34650328 missense possibly damaging 0.82
R2032:Nop14 UTSW 5 34659939 missense possibly damaging 0.65
R4033:Nop14 UTSW 5 34650517 missense probably benign
R4168:Nop14 UTSW 5 34656744 missense probably damaging 0.99
R4172:Nop14 UTSW 5 34650607 missense probably damaging 0.99
R4618:Nop14 UTSW 5 34639218 missense probably damaging 1.00
R4936:Nop14 UTSW 5 34652393 missense probably damaging 1.00
R6067:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6075:Nop14 UTSW 5 34659891 missense probably damaging 1.00
R6078:Nop14 UTSW 5 34657951 missense probably damaging 1.00
R6284:Nop14 UTSW 5 34641491 unclassified probably null
R7295:Nop14 UTSW 5 34639032 missense probably damaging 0.99
R7585:Nop14 UTSW 5 34644780 missense probably damaging 1.00
R7626:Nop14 UTSW 5 34651791 missense probably damaging 0.99
U15987:Nop14 UTSW 5 34657951 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACATCAACATCAGAGGTGTAAGC -3'
(R):5'- AAAACTGCCCTTGGAGAAGCG -3'

Sequencing Primer
(F):5'- CAACATCAGAGGTGTAAGCTTAATG -3'
(R):5'- AGCGTTGACAGAGTTCTACC -3'
Posted On2015-02-19