Incidental Mutation 'R3693:Tas2r143'
ID268855
Institutional Source Beutler Lab
Gene Symbol Tas2r143
Ensembl Gene ENSMUSG00000046652
Gene Nametaste receptor, type 2, member 143
Synonymsmt2r36, Tas2r43
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R3693 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42400238-42401119 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42400976 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 247 (V247I)
Ref Sequence ENSEMBL: ENSMUSP00000057910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect probably benign
Transcript: ENSMUST00000057398
AA Change: V247I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652
AA Change: V247I

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070178
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Ces2e A G 8: 104,928,811 D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Nop14 T C 5: 34,654,438 K202E probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Tas2r143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Tas2r143 APN 6 42400334 nonsense probably null
IGL02832:Tas2r143 APN 6 42400325 missense possibly damaging 0.55
R0125:Tas2r143 UTSW 6 42400955 missense probably benign 0.01
R1035:Tas2r143 UTSW 6 42400265 missense probably benign 0.16
R1073:Tas2r143 UTSW 6 42400760 missense probably benign 0.01
R1400:Tas2r143 UTSW 6 42400383 missense probably benign 0.35
R1774:Tas2r143 UTSW 6 42400371 missense probably damaging 1.00
R2391:Tas2r143 UTSW 6 42400876 missense probably damaging 0.99
R3617:Tas2r143 UTSW 6 42401063 missense probably benign 0.20
R4283:Tas2r143 UTSW 6 42401073 unclassified probably null
R4486:Tas2r143 UTSW 6 42400694 missense probably benign 0.15
R5005:Tas2r143 UTSW 6 42400724 missense probably benign 0.02
R6360:Tas2r143 UTSW 6 42400835 missense probably benign 0.40
R7163:Tas2r143 UTSW 6 42400268 missense probably benign
R7827:Tas2r143 UTSW 6 42400722 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCTCATGTGGTTCACTCC -3'
(R):5'- GCAAGCAGAGACACCTTTGGTC -3'

Sequencing Primer
(F):5'- ATGTGGTTCACTCCTTTCTTCCTG -3'
(R):5'- CAGAGACACCTTTGGTCCAAGG -3'
Posted On2015-02-19