Incidental Mutation 'R3693:Osbpl8'
ID268864
Institutional Source Beutler Lab
Gene Symbol Osbpl8
Ensembl Gene ENSMUSG00000020189
Gene Nameoxysterol binding protein-like 8
SynonymsD330025H14Rik, ORP-8
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R3693 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location111164752-111297249 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111269436 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 251 (S251T)
Ref Sequence ENSEMBL: ENSMUSP00000100911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095310] [ENSMUST00000105275]
Predicted Effect probably benign
Transcript: ENSMUST00000095310
AA Change: S209T

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000092948
Gene: ENSMUSG00000020189
AA Change: S209T

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
coiled coil region 71 102 N/A INTRINSIC
PH 107 225 3.65e-16 SMART
Pfam:Oxysterol_BP 364 715 6.4e-91 PFAM
coiled coil region 789 811 N/A INTRINSIC
transmembrane domain 829 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105275
AA Change: S251T

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000100911
Gene: ENSMUSG00000020189
AA Change: S251T

DomainStartEndE-ValueType
low complexity region 85 101 N/A INTRINSIC
coiled coil region 113 144 N/A INTRINSIC
PH 149 267 3.65e-16 SMART
Pfam:Oxysterol_BP 406 752 4.6e-91 PFAM
coiled coil region 831 853 N/A INTRINSIC
transmembrane domain 871 888 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220139
Meta Mutation Damage Score 0.1661 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene encodes a member of the oxysterol-binding protein (Osbp) family, a group of intracellular lipid receptors. Like most members, the encoded protein contains an N-terminal pleckstrin homology domain and a highly conserved C-terminal Osbp-like sterol-binding domain. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit elevated of HDL and gender-specific alterations in lipid metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Ces2e A G 8: 104,928,811 D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Nop14 T C 5: 34,654,438 K202E probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Tas2r143 G A 6: 42,400,976 V247I probably benign Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Osbpl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00785:Osbpl8 APN 10 111273044 missense probably benign 0.30
IGL00826:Osbpl8 APN 10 111272320 splice site probably benign
IGL00839:Osbpl8 APN 10 111291510 missense probably benign 0.01
IGL01148:Osbpl8 APN 10 111276563 splice site probably benign
IGL01338:Osbpl8 APN 10 111267747 missense probably damaging 0.99
IGL01927:Osbpl8 APN 10 111270616 missense probably benign 0.00
IGL02378:Osbpl8 APN 10 111282145 missense possibly damaging 0.94
IGL02863:Osbpl8 APN 10 111284425 splice site probably benign
IGL02933:Osbpl8 APN 10 111282130 missense probably damaging 1.00
IGL03075:Osbpl8 APN 10 111291556 missense probably benign 0.01
R0388:Osbpl8 UTSW 10 111272282 missense probably benign
R0725:Osbpl8 UTSW 10 111286240 missense possibly damaging 0.64
R1353:Osbpl8 UTSW 10 111276479 missense probably damaging 0.97
R1434:Osbpl8 UTSW 10 111291581 missense probably benign 0.01
R1803:Osbpl8 UTSW 10 111275049 missense probably damaging 1.00
R1939:Osbpl8 UTSW 10 111289811 missense probably benign 0.19
R2847:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2848:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2849:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2879:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R2935:Osbpl8 UTSW 10 111269436 missense probably benign 0.27
R4088:Osbpl8 UTSW 10 111289790 missense possibly damaging 0.52
R4374:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4376:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4377:Osbpl8 UTSW 10 111269419 missense possibly damaging 0.93
R4621:Osbpl8 UTSW 10 111269418 missense probably benign 0.01
R4622:Osbpl8 UTSW 10 111291496 missense probably benign 0.00
R4851:Osbpl8 UTSW 10 111204800 start codon destroyed probably null 0.00
R5134:Osbpl8 UTSW 10 111288693 missense probably benign 0.28
R5179:Osbpl8 UTSW 10 111272164 missense probably benign 0.01
R5309:Osbpl8 UTSW 10 111270557 missense probably benign 0.00
R5590:Osbpl8 UTSW 10 111272168 missense probably damaging 0.98
R5783:Osbpl8 UTSW 10 111267783 nonsense probably null
R6293:Osbpl8 UTSW 10 111272238 missense possibly damaging 0.96
R6362:Osbpl8 UTSW 10 111273068 nonsense probably null
R6527:Osbpl8 UTSW 10 111293205 missense probably benign 0.23
R6751:Osbpl8 UTSW 10 111275013 missense possibly damaging 0.67
R6851:Osbpl8 UTSW 10 111270618 nonsense probably null
R6955:Osbpl8 UTSW 10 111269444 critical splice donor site probably null
R7224:Osbpl8 UTSW 10 111275011 missense possibly damaging 0.94
R7235:Osbpl8 UTSW 10 111269427 missense probably benign
R7685:Osbpl8 UTSW 10 111276509 nonsense probably null
RF007:Osbpl8 UTSW 10 111276467 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTGCCTGATGAATCCATATCTG -3'
(R):5'- AAGCATTCATGTGTCAGTGGAGAG -3'

Sequencing Primer
(F):5'- GCCTGATGAATCCATATCTGATAAG -3'
(R):5'- TGCACTGTTAACACGGCC -3'
Posted On2015-02-19