Incidental Mutation 'R3693:Stxbp5l'
ID 268876
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 040688-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3693 (G1)
Quality Score 201
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 37061708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 367 (Y367*)
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114775] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114775
AA Change: Y367*
SMART Domains Protein: ENSMUSP00000110423
Gene: ENSMUSG00000022829
AA Change: Y367*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 3.5e-45 PFAM
Blast:WD40 397 466 6e-43 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114780
AA Change: Y367*
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: Y367*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
AA Change: Y367*
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: Y367*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
AA Change: Y367*
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: Y367*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
AA Change: Y367*
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: Y367*

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 111,466,012 (GRCm39) L187F probably damaging Het
Ankrd29 G A 18: 12,387,757 (GRCm39) A275V possibly damaging Het
Cabp2 A G 19: 4,133,593 (GRCm39) T12A probably benign Het
Ccdc158 T C 5: 92,757,904 (GRCm39) E1056G probably damaging Het
Cdhr2 A G 13: 54,874,229 (GRCm39) Y767C probably damaging Het
Ces2e A G 8: 105,655,443 (GRCm39) D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 73,221,755 (GRCm39) probably benign Het
Chsy3 A T 18: 59,309,080 (GRCm39) Q111L possibly damaging Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Cyp11b2 C T 15: 74,727,857 (GRCm39) R75Q probably benign Het
Dnaja2 T C 8: 86,273,249 (GRCm39) K223E probably damaging Het
Dtx3 T C 10: 127,027,293 (GRCm39) I294V probably benign Het
Eps15l1 A G 8: 73,152,904 (GRCm39) probably benign Het
Exd2 A G 12: 80,527,467 (GRCm39) Y220C probably damaging Het
Eya1 A G 1: 14,299,725 (GRCm39) Y343H probably damaging Het
Hif3a T C 7: 16,774,999 (GRCm39) E533G probably damaging Het
Kalrn T A 16: 34,177,685 (GRCm39) Y178F probably damaging Het
Mageb4 G T X: 85,296,000 (GRCm39) R10S probably damaging Het
Muc6 A G 7: 141,234,946 (GRCm39) probably benign Het
Myh11 C A 16: 14,035,813 (GRCm39) E1038D probably benign Het
Nfxl1 T C 5: 72,697,954 (GRCm39) Y297C probably damaging Het
Nop14 T C 5: 34,811,782 (GRCm39) K202E probably damaging Het
Or5b112 T C 19: 13,319,893 (GRCm39) I257T possibly damaging Het
Osbpl8 T A 10: 111,105,297 (GRCm39) S251T probably benign Het
Pcdha1 A T 18: 37,065,361 (GRCm39) K675I possibly damaging Het
Pigw A G 11: 84,769,209 (GRCm39) I40T probably benign Het
Pip5k1a A T 3: 94,985,498 (GRCm39) probably benign Het
Ptprh G T 7: 4,557,234 (GRCm39) Q687K probably damaging Het
Rbm4 A G 19: 4,837,411 (GRCm39) Y358H probably damaging Het
Rft1 T A 14: 30,412,408 (GRCm39) C490S probably damaging Het
Rims2 A T 15: 39,341,971 (GRCm39) T887S probably benign Het
Ripk2 A T 4: 16,127,695 (GRCm39) L349Q probably benign Het
Strn T C 17: 78,964,421 (GRCm39) N515D probably damaging Het
Tas2r143 G A 6: 42,377,910 (GRCm39) V247I probably benign Het
Togaram1 A T 12: 65,030,283 (GRCm39) Y1029F probably benign Het
Ugt1a6b A G 1: 88,035,516 (GRCm39) T285A probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 36,950,159 (GRCm39) critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37,024,883 (GRCm39) missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37,068,231 (GRCm39) critical splice donor site probably null
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R1670:Stxbp5l UTSW 16 37,111,289 (GRCm39) critical splice donor site probably null
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37,008,991 (GRCm39) missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8961:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9226:Stxbp5l UTSW 16 37,076,206 (GRCm39) missense probably damaging 0.96
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCAAGTAGGAGCAAGTGC -3'
(R):5'- TGTAGATAATCTCCTCTGAACCTG -3'

Sequencing Primer
(F):5'- AGCAAGTGCAGAGCCTG -3'
(R):5'- ATCTCCTCTGAACCTGTCATTTAATG -3'
Posted On 2015-02-19