Incidental Mutation 'R3693:Ankrd29'
ID268879
Institutional Source Beutler Lab
Gene Symbol Ankrd29
Ensembl Gene ENSMUSG00000057766
Gene Nameankyrin repeat domain 29
Synonyms
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R3693 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12252362-12305720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12254700 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 275 (A275V)
Ref Sequence ENSEMBL: ENSMUSP00000114028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118525] [ENSMUST00000122408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118525
AA Change: A275V

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114028
Gene: ENSMUSG00000057766
AA Change: A275V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
ANK 242 271 3.01e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122408
AA Change: A242V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112888
Gene: ENSMUSG00000057766
AA Change: A242V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137948
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Ces2e A G 8: 104,928,811 D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Nop14 T C 5: 34,654,438 K202E probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Tas2r143 G A 6: 42,400,976 V247I probably benign Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Ankrd29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Ankrd29 APN 18 12275738 missense probably benign 0.00
IGL02956:Ankrd29 APN 18 12260936 missense probably damaging 1.00
R0456:Ankrd29 UTSW 18 12295979 missense probably damaging 1.00
R2879:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3694:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3699:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3700:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4130:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4132:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4745:Ankrd29 UTSW 18 12254622 missense probably benign 0.00
R4989:Ankrd29 UTSW 18 12262185 missense probably damaging 1.00
R5531:Ankrd29 UTSW 18 12279778 missense probably damaging 1.00
R5985:Ankrd29 UTSW 18 12279775 missense probably damaging 1.00
R6187:Ankrd29 UTSW 18 12279690 nonsense probably null
R6627:Ankrd29 UTSW 18 12262164 missense probably benign 0.02
R6895:Ankrd29 UTSW 18 12260989 missense probably benign 0.36
R7671:Ankrd29 UTSW 18 12260986 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTATAGGGCAGTGTGAGAAGCC -3'
(R):5'- AACAGCGGGTACTACTTCTCATTAG -3'

Sequencing Primer
(F):5'- CCACAGGGCAGACATTCTTTC -3'
(R):5'- TAAGTCCAGTGGAGGCTT -3'
Posted On2015-02-19