Incidental Mutation 'R3693:Mageb4'
ID268884
Institutional Source Beutler Lab
Gene Symbol Mageb4
Ensembl Gene ENSMUSG00000035427
Gene Namemelanoma antigen, family B, 4
SynonymsmMage-b4, Mage-b4, CN716893
MMRRC Submission 040688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.017) question?
Stock #R3693 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location86250254-86305093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86252394 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 10 (R10S)
Ref Sequence ENSEMBL: ENSMUSP00000109602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096378] [ENSMUST00000113969]
Predicted Effect probably damaging
Transcript: ENSMUST00000096378
AA Change: R10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094107
Gene: ENSMUSG00000035427
AA Change: R10S

DomainStartEndE-ValueType
Pfam:MAGE_N 3 97 7e-24 PFAM
Pfam:MAGE 118 288 3e-52 PFAM
internal_repeat_1 311 408 1.8e-29 PROSPERO
internal_repeat_1 458 555 1.8e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113969
AA Change: R10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109602
Gene: ENSMUSG00000035427
AA Change: R10S

DomainStartEndE-ValueType
MAGE_N 3 95 1.15e-16 SMART
MAGE 118 288 1.17e-104 SMART
internal_repeat_1 311 408 1.8e-29 PROSPERO
internal_repeat_1 458 555 1.8e-29 PROSPERO
Meta Mutation Damage Score 0.4369 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region. It is expressed in testis and placenta, and in a significant fraction of tumors of various histological types. The MAGEB genes are clustered on chromosome Xp22-p21. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Cdhr2 A G 13: 54,726,416 Y767C probably damaging Het
Ces2e A G 8: 104,928,811 D122G probably damaging Het
Cherp TTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTG 8: 72,467,911 probably benign Het
Chsy3 A T 18: 59,176,008 Q111L possibly damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp11b2 C T 15: 74,856,008 R75Q probably benign Het
Dnaja2 T C 8: 85,546,620 K223E probably damaging Het
Dtx3 T C 10: 127,191,424 I294V probably benign Het
Eps15l1 A G 8: 72,399,060 probably benign Het
Exd2 A G 12: 80,480,693 Y220C probably damaging Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Hif3a T C 7: 17,041,074 E533G probably damaging Het
Kalrn T A 16: 34,357,315 Y178F probably damaging Het
Muc6 A G 7: 141,648,681 probably benign Het
Myh11 C A 16: 14,217,949 E1038D probably benign Het
Nfxl1 T C 5: 72,540,611 Y297C probably damaging Het
Nop14 T C 5: 34,654,438 K202E probably damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Pcdha1 A T 18: 36,932,308 K675I possibly damaging Het
Pigw A G 11: 84,878,383 I40T probably benign Het
Pip5k1a A T 3: 95,078,187 probably benign Het
Ptprh G T 7: 4,554,235 Q687K probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Rft1 T A 14: 30,690,451 C490S probably damaging Het
Rims2 A T 15: 39,478,575 T887S probably benign Het
Ripk2 A T 4: 16,127,695 L349Q probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Tas2r143 G A 6: 42,400,976 V247I probably benign Het
Togaram1 A T 12: 64,983,509 Y1029F probably benign Het
Ugt1a6b A G 1: 88,107,794 T285A probably benign Het
Other mutations in Mageb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3695:Mageb4 UTSW X 86252394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTTGAGATTTAGACTTTTGAGG -3'
(R):5'- ATGACAGGCCATGTGGATTC -3'

Sequencing Primer
(F):5'- ATTTAGACTTTTGAGGGAAGCCAGC -3'
(R):5'- CAGGCCATGTGGATTCCTAGAATAG -3'
Posted On2015-02-19