Incidental Mutation 'R3694:Cnga3'
ID268887
Institutional Source Beutler Lab
Gene Symbol Cnga3
Ensembl Gene ENSMUSG00000026114
Gene Namecyclic nucleotide gated channel alpha 3
SynonymsCNG3
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location37214434-37263384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37261740 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 552 (Y552H)
Ref Sequence ENSEMBL: ENSMUSP00000142175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027288] [ENSMUST00000194195] [ENSMUST00000195272]
Predicted Effect probably damaging
Transcript: ENSMUST00000027288
AA Change: Y514H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027288
Gene: ENSMUSG00000026114
AA Change: Y514H

DomainStartEndE-ValueType
Pfam:Ion_trans 109 351 1.3e-30 PFAM
cNMP 423 547 2.5e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000194195
AA Change: Y514H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142075
Gene: ENSMUSG00000026114
AA Change: Y514H

DomainStartEndE-ValueType
Pfam:Ion_trans 146 340 1.3e-15 PFAM
cNMP 423 547 2.4e-28 SMART
PDB:3SWY|C 567 610 2e-14 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000195272
AA Change: Y552H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142175
Gene: ENSMUSG00000026114
AA Change: Y552H

DomainStartEndE-ValueType
Pfam:Ion_trans 184 378 1.5e-15 PFAM
cNMP 461 585 2.4e-28 SMART
PDB:3SWY|C 605 648 3e-14 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclic nucleotide-gated cation channel protein family which is required for normal vision and olfactory signal transduction. Mutations in this gene are associated with achromatopsia (rod monochromacy) and color blindness. Two alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant animals experience progressive loss of cone photoreceptor cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Cnga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Cnga3 APN 1 37260793 missense possibly damaging 0.89
IGL01677:Cnga3 APN 1 37244918 nonsense probably null
IGL02475:Cnga3 APN 1 37257991 critical splice acceptor site probably null
IGL03145:Cnga3 APN 1 37261674 missense probably damaging 1.00
R1557:Cnga3 UTSW 1 37260985 missense probably damaging 1.00
R1622:Cnga3 UTSW 1 37244828 splice site probably benign
R1678:Cnga3 UTSW 1 37261498 missense possibly damaging 0.94
R1938:Cnga3 UTSW 1 37261873 missense possibly damaging 0.95
R2968:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R2969:Cnga3 UTSW 1 37261078 missense probably damaging 1.00
R3406:Cnga3 UTSW 1 37262065 missense probably benign 0.00
R4079:Cnga3 UTSW 1 37241865 missense possibly damaging 0.70
R4850:Cnga3 UTSW 1 37258006 nonsense probably null
R4907:Cnga3 UTSW 1 37241942 critical splice donor site probably null
R5802:Cnga3 UTSW 1 37260925 missense probably damaging 0.98
R6135:Cnga3 UTSW 1 37232237 start gained probably benign
R6586:Cnga3 UTSW 1 37261278 missense probably damaging 0.99
R6997:Cnga3 UTSW 1 37244884 missense probably benign 0.34
R7630:Cnga3 UTSW 1 37258046 missense probably damaging 1.00
R7799:Cnga3 UTSW 1 37261771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCTTCCAGGACTGCGAGG -3'
(R):5'- AAACCTCGTCTGCAGGATGTC -3'

Sequencing Primer
(F):5'- AGCCCCGGGGACTACATATG -3'
(R):5'- AGGGACGACTCCAGGTACTC -3'
Posted On2015-02-19