Incidental Mutation 'R3694:AI182371'
ID268890
Institutional Source Beutler Lab
Gene Symbol AI182371
Ensembl Gene ENSMUSG00000035875
Gene Nameexpressed sequence AI182371
Synonyms
MMRRC Submission 040689-MU
Accession Numbers

Genbank: NM_178885; MGI: 2138853

Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location35081861-35101543 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35085752 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 267 (C267R)
Ref Sequence ENSEMBL: ENSMUSP00000154033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045776] [ENSMUST00000134940] [ENSMUST00000226375] [ENSMUST00000226631] [ENSMUST00000226972]
Predicted Effect probably benign
Transcript: ENSMUST00000045776
AA Change: C257R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000037754
Gene: ENSMUSG00000035875
AA Change: C257R

DomainStartEndE-ValueType
Pfam:A2M_N 133 227 4.7e-19 PFAM
ANATO 284 318 1.97e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154817
Predicted Effect probably benign
Transcript: ENSMUST00000226375
Predicted Effect probably benign
Transcript: ENSMUST00000226631
AA Change: C268R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000226972
AA Change: C267R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in AI182371
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02338:AI182371 APN 2 35085716 missense probably benign 0.02
IGL02344:AI182371 APN 2 35089186 missense probably benign 0.01
IGL02817:AI182371 APN 2 35100649 missense probably damaging 0.99
IGL02961:AI182371 APN 2 35086112 missense possibly damaging 0.53
3-1:AI182371 UTSW 2 35100607 missense probably damaging 0.99
R0041:AI182371 UTSW 2 35085721 missense possibly damaging 0.79
R0084:AI182371 UTSW 2 35085702 critical splice donor site probably null
R0472:AI182371 UTSW 2 35085206 missense probably benign 0.35
R1539:AI182371 UTSW 2 35088803 missense probably damaging 0.98
R1634:AI182371 UTSW 2 35086485 missense probably damaging 1.00
R1635:AI182371 UTSW 2 35088737 splice site probably null
R1898:AI182371 UTSW 2 35100649 missense probably damaging 0.99
R2065:AI182371 UTSW 2 35086429 critical splice donor site probably null
R2155:AI182371 UTSW 2 35085354 missense probably benign 0.00
R3900:AI182371 UTSW 2 35085216 missense probably benign 0.01
R4766:AI182371 UTSW 2 35095817 missense possibly damaging 0.78
R5071:AI182371 UTSW 2 35085215 missense probably benign 0.17
R5500:AI182371 UTSW 2 35100638 missense probably damaging 0.99
R5907:AI182371 UTSW 2 35086122 missense possibly damaging 0.66
R6146:AI182371 UTSW 2 35097971 missense probably damaging 1.00
R6333:AI182371 UTSW 2 35085269 missense probably damaging 0.99
R6729:AI182371 UTSW 2 35084705 intron probably benign
R6732:AI182371 UTSW 2 35084705 intron probably benign
R6742:AI182371 UTSW 2 35084705 intron probably benign
R6781:AI182371 UTSW 2 35084705 intron probably benign
R7196:AI182371 UTSW 2 35086429 critical splice donor site probably null
R7381:AI182371 UTSW 2 35085359 missense probably damaging 1.00
R7458:AI182371 UTSW 2 35086504 missense possibly damaging 0.95
R7466:AI182371 UTSW 2 35088741 nonsense probably null
RF009:AI182371 UTSW 2 35089197 missense possibly damaging 0.90
Z1177:AI182371 UTSW 2 35095759 critical splice donor site unknown
Predicted Primers PCR Primer
(F):5'- CCCAGGTTAAGGATATGGCC -3'
(R):5'- GTTTCCTGAGACCTTTCTAGGC -3'

Sequencing Primer
(F):5'- GGGGTGAATTAATCCTCTACATCTGC -3'
(R):5'- CCTGAGACCTTTCTAGGCTTATGG -3'
Posted On2015-02-19