Incidental Mutation 'R3694:4833423E24Rik'
ID268892
Institutional Source Beutler Lab
Gene Symbol 4833423E24Rik
Ensembl Gene ENSMUSG00000075217
Gene NameRIKEN cDNA 4833423E24 gene
Synonyms
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85483594-85519024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 85494110 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 291 (I291L)
Ref Sequence ENSEMBL: ENSMUSP00000097507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099923]
Predicted Effect probably benign
Transcript: ENSMUST00000099923
AA Change: I291L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097507
Gene: ENSMUSG00000075217
AA Change: I291L

DomainStartEndE-ValueType
Cyt-b5 65 139 6.6e-20 SMART
transmembrane domain 176 195 N/A INTRINSIC
Pfam:FA_desaturase 200 462 1.7e-39 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in 4833423E24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:4833423E24Rik APN 2 85518555 missense probably damaging 1.00
IGL02348:4833423E24Rik APN 2 85493296 missense possibly damaging 0.70
IGL02701:4833423E24Rik APN 2 85484169 missense probably damaging 1.00
IGL02833:4833423E24Rik APN 2 85502207 missense possibly damaging 0.46
IGL03152:4833423E24Rik APN 2 85500304 missense probably damaging 0.98
IGL03283:4833423E24Rik APN 2 85490407 missense probably damaging 1.00
R0083:4833423E24Rik UTSW 2 85494132 missense possibly damaging 0.50
R0329:4833423E24Rik UTSW 2 85518551 missense probably benign 0.11
R0330:4833423E24Rik UTSW 2 85518551 missense probably benign 0.11
R0943:4833423E24Rik UTSW 2 85488765 missense probably damaging 0.99
R2100:4833423E24Rik UTSW 2 85500249 missense probably damaging 1.00
R3803:4833423E24Rik UTSW 2 85508338 splice site probably null
R3952:4833423E24Rik UTSW 2 85500204 splice site probably benign
R4161:4833423E24Rik UTSW 2 85518509 missense probably damaging 1.00
R4630:4833423E24Rik UTSW 2 85518646 nonsense probably null
R5765:4833423E24Rik UTSW 2 85484194 critical splice acceptor site probably null
R6104:4833423E24Rik UTSW 2 85508349 nonsense probably null
R6314:4833423E24Rik UTSW 2 85502176 missense probably benign 0.07
R6891:4833423E24Rik UTSW 2 85488805 missense possibly damaging 0.80
R6891:4833423E24Rik UTSW 2 85488813 missense probably damaging 1.00
R7027:4833423E24Rik UTSW 2 85485527 missense probably damaging 1.00
R7235:4833423E24Rik UTSW 2 85500219 missense probably damaging 1.00
R7635:4833423E24Rik UTSW 2 85500237 missense probably benign 0.38
X0021:4833423E24Rik UTSW 2 85518701 missense probably benign 0.00
Z1088:4833423E24Rik UTSW 2 85484181 missense probably damaging 1.00
Z1088:4833423E24Rik UTSW 2 85502077 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- CTCAAGTAGGGTGACACAGG -3'
(R):5'- CAACAATGAGGGTTACTTGGGG -3'

Sequencing Primer
(F):5'- CTCTGGGAGTCTGCACTAAGTGAC -3'
(R):5'- AGGGTTACTTGGGGGAAATTTTTC -3'
Posted On2015-02-19