Incidental Mutation 'R3694:Fmo5'
ID268894
Institutional Source Beutler Lab
Gene Symbol Fmo5
Ensembl Gene ENSMUSG00000028088
Gene Nameflavin containing monooxygenase 5
Synonyms
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location97628804-97655282 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97645914 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 393 (F393L)
Ref Sequence ENSEMBL: ENSMUSP00000102665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029729] [ENSMUST00000107049] [ENSMUST00000107050]
Predicted Effect probably damaging
Transcript: ENSMUST00000029729
AA Change: F393L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029729
Gene: ENSMUSG00000028088
AA Change: F393L

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107049
AA Change: F393L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102664
Gene: ENSMUSG00000028088
AA Change: F393L

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 5 224 3.4e-8 PFAM
Pfam:Pyr_redox_3 7 221 2.2e-21 PFAM
Pfam:NAD_binding_8 8 69 1.7e-6 PFAM
Pfam:K_oxygenase 81 223 9.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107050
AA Change: F393L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000102665
Gene: ENSMUSG00000028088
AA Change: F393L

DomainStartEndE-ValueType
Pfam:FMO-like 3 533 9.7e-280 PFAM
Pfam:Pyr_redox_2 4 228 8.5e-11 PFAM
Pfam:Pyr_redox_3 7 221 4.7e-11 PFAM
Pfam:NAD_binding_8 8 70 3.5e-7 PFAM
Pfam:K_oxygenase 80 222 2.9e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Metabolic N-oxidation of the diet-derived amino-trimethylamine (TMA) is mediated by flavin-containing monooxygenase and is subject to an inherited FMO3 polymorphism in man resulting in a small subpopulation with reduced TMA N-oxidation capacity resulting in fish odor syndrome Trimethylaminuria. Three forms of the enzyme, FMO1 found in fetal liver, FMO2 found in adult liver, and FMO3 are encoded by genes clustered in the 1q23-q25 region. Flavin-containing monooxygenases are NADPH-dependent flavoenzymes that catalyzes the oxidation of soft nucleophilic heteroatom centers in drugs, pesticides, and xenobiotics. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele show an age-related lean phenotype despite increased food intake, lower plasma levels of glucose and cholesterol, decreased fat storage in WAT, altered fatty acid oxidation, increased energy expenditure and respiratory quotient but normal physical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Fmo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01469:Fmo5 APN 3 97651568 missense probably benign 0.19
IGL01926:Fmo5 APN 3 97637481 missense probably damaging 1.00
IGL03062:Fmo5 APN 3 97635593 missense probably damaging 1.00
IGL03215:Fmo5 APN 3 97641806 missense probably benign
IGL03323:Fmo5 APN 3 97639007 splice site probably null
PIT4445001:Fmo5 UTSW 3 97651528 missense probably benign 0.30
R0133:Fmo5 UTSW 3 97645636 missense probably damaging 0.99
R0207:Fmo5 UTSW 3 97645681 missense probably damaging 1.00
R0570:Fmo5 UTSW 3 97629140 missense probably damaging 1.00
R2014:Fmo5 UTSW 3 97635682 missense possibly damaging 0.56
R2093:Fmo5 UTSW 3 97645878 missense probably benign 0.41
R3087:Fmo5 UTSW 3 97641695 missense probably damaging 1.00
R3764:Fmo5 UTSW 3 97645717 missense probably damaging 1.00
R4864:Fmo5 UTSW 3 97645879 missense probably damaging 1.00
R4987:Fmo5 UTSW 3 97635578 missense probably benign 0.23
R5152:Fmo5 UTSW 3 97641762 missense probably benign 0.00
R5304:Fmo5 UTSW 3 97651622 missense probably damaging 1.00
R5306:Fmo5 UTSW 3 97641760 missense probably benign 0.00
R5563:Fmo5 UTSW 3 97638891 missense probably damaging 1.00
R5888:Fmo5 UTSW 3 97641725 missense probably benign 0.10
R6352:Fmo5 UTSW 3 97645675 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGTGGTCATCTTTGCCACAGG -3'
(R):5'- AAAGTCATACCTGCCCTGTAAG -3'

Sequencing Primer
(F):5'- ACAGGCTACAGCTTTGCC -3'
(R):5'- GCGTGTATAGATACAGCATGTCTAG -3'
Posted On2015-02-19