Incidental Mutation 'R3694:Gpr63'
ID268895
Institutional Source Beutler Lab
Gene Symbol Gpr63
Ensembl Gene ENSMUSG00000040372
Gene NameG protein-coupled receptor 63
SynonymsPSP24beta
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location24966407-25009233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25007993 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 239 (Y239C)
Ref Sequence ENSEMBL: ENSMUSP00000039312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038920]
Predicted Effect probably damaging
Transcript: ENSMUST00000038920
AA Change: Y239C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039312
Gene: ENSMUSG00000040372
AA Change: Y239C

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 98 392 1.3e-8 PFAM
Pfam:7tm_1 104 377 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151006
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Gpr63
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01576:Gpr63 APN 4 25008445 missense possibly damaging 0.78
IGL01673:Gpr63 APN 4 25008014 missense probably benign 0.04
IGL01861:Gpr63 APN 4 25008545 missense probably damaging 0.98
IGL02082:Gpr63 APN 4 25008564 utr 3 prime probably benign
R0003:Gpr63 UTSW 4 25007651 missense probably damaging 1.00
R0554:Gpr63 UTSW 4 25007447 missense probably benign
R0729:Gpr63 UTSW 4 25007480 missense probably benign 0.02
R1506:Gpr63 UTSW 4 25008227 missense probably damaging 1.00
R3103:Gpr63 UTSW 4 25007353 missense probably benign 0.00
R4021:Gpr63 UTSW 4 25008470 missense possibly damaging 0.77
R4807:Gpr63 UTSW 4 25007446 missense probably benign
R4967:Gpr63 UTSW 4 25008368 nonsense probably null
R5047:Gpr63 UTSW 4 25008202 missense probably benign 0.44
R5325:Gpr63 UTSW 4 25007294 missense probably benign 0.00
R5382:Gpr63 UTSW 4 25007952 missense probably benign
R7047:Gpr63 UTSW 4 25007320 missense probably benign 0.00
R7216:Gpr63 UTSW 4 25008038 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCTTCTGCCGGTTGTCG -3'
(R):5'- CATGAGACCGAGTTTGCTGG -3'

Sequencing Primer
(F):5'- AGTAGCCATCCTGCTCATTATTAG -3'
(R):5'- ACCGAGTTTGCTGGCCTGG -3'
Posted On2015-02-19