Incidental Mutation 'R3694:Dmrta1'
ID268896
Institutional Source Beutler Lab
Gene Symbol Dmrta1
Ensembl Gene ENSMUSG00000043753
Gene Namedoublesex and mab-3 related transcription factor like family A1
SynonymsDmrt4
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location89679436-89694772 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 89692178 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 458 (Y458*)
Ref Sequence ENSEMBL: ENSMUSP00000057488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052478]
Predicted Effect probably null
Transcript: ENSMUST00000052478
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000057488
Gene: ENSMUSG00000043753
AA Change: Y458*

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DM 82 135 2.31e-30 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:DMA 314 350 3.3e-21 PFAM
low complexity region 393 404 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131576
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile; however, females exhibit polyovular ovarian follicles while 25% of males display abnormal copulatory behavior toward other males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Dmrta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02154:Dmrta1 APN 4 89691913 missense probably benign 0.04
IGL02572:Dmrta1 APN 4 89691558 missense probably benign 0.01
IGL02875:Dmrta1 APN 4 89691748 missense possibly damaging 0.70
IGL02883:Dmrta1 APN 4 89688774 missense probably benign
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0394:Dmrta1 UTSW 4 89692039 missense probably damaging 1.00
R2093:Dmrta1 UTSW 4 89691505 missense probably benign
R2132:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2133:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2401:Dmrta1 UTSW 4 89691616 missense probably benign 0.00
R3695:Dmrta1 UTSW 4 89692178 nonsense probably null
R3891:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3892:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3929:Dmrta1 UTSW 4 89691444 nonsense probably null
R4620:Dmrta1 UTSW 4 89688784 missense probably benign 0.05
R4927:Dmrta1 UTSW 4 89691748 missense probably damaging 1.00
R4982:Dmrta1 UTSW 4 89688564 missense probably damaging 1.00
R5312:Dmrta1 UTSW 4 89692047 missense probably damaging 0.99
R5437:Dmrta1 UTSW 4 89691756 missense possibly damaging 0.71
R5637:Dmrta1 UTSW 4 89688831 missense probably benign
R6185:Dmrta1 UTSW 4 89691768 missense probably damaging 0.97
R6906:Dmrta1 UTSW 4 89691966 missense probably benign 0.06
R7156:Dmrta1 UTSW 4 89688463 missense probably damaging 0.99
R7201:Dmrta1 UTSW 4 89692171 nonsense probably null
R7755:Dmrta1 UTSW 4 89691933 missense probably benign 0.01
R7862:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7880:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
R7945:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7963:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCCTCTTGAAGCTGCGTCTG -3'
(R):5'- TGAGAGGCCAAGCTTATGC -3'

Sequencing Primer
(F):5'- GCTGCTTATGGAGGAGATTCAACTC -3'
(R):5'- AGTACATTAAAAAGTGTGTGTGTGTG -3'
Posted On2015-02-19