Mutagenetix > Incidental Mutations

Incidental Mutation 'R3694:Mutyh'

268897

Institutional Source

Beutler Lab

Gene Symbol

Mutyh

Ensembl Gene

ENSMUSG00000028687

Gene Name

mutY DNA glycosylase

Synonyms

Mutyha, 5730495A01Rik, Mutyhb, Mutyhc, Myh, Mutyhalpha, Mutyhbeta

MMRRC Submission

040689-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

116807723-116819440 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 116816454 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 146 (S146T)

Ref Sequence

ENSEMBL: ENSMUSP00000099760 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055436] [ENSMUST00000102699] [ENSMUST00000130359] [ENSMUST00000155346]

Predicted Effect

probably benign
Transcript: ENSMUST00000055436

SMART Domains

Protein: ENSMUSP00000062327
Gene: ENSMUSG00000043155

Domain	Start	End	E-Value	Type
SCOP:d1cjxa2	3	144	6e-7	SMART
PDB:1T47\|B	4	367	8e-32	PDB
SCOP:d1cjxa2	161	367	5e-29	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102699
AA Change: S146T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687
AA Change: S146T

Domain	Start	End	E-Value	Type
ENDO3c	107	259	1.46e-52	SMART
FES	260	280	2.16e-5	SMART
Pfam:NUDIX_4	353	463	2.3e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124857

Predicted Effect

probably benign
Transcript: ENSMUST00000130359

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138056

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140680

Predicted Effect

unknown
Transcript: ENSMUST00000155346
AA Change: V121D

SMART Domains

Protein: ENSMUSP00000122777
Gene: ENSMUSG00000028687
AA Change: V121D

Domain	Start	End	E-Value	Type
PDB:3N5N\|Y	50	100	3e-20	PDB
SCOP:d1keaa_	59	86	3e-3	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. Mutations in this gene result in heritable predisposition to colon and stomach cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no increase in tumor incidence relative to wild-type through 17 months of age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,550,516	I97V	possibly damaging	Het
4833423E24Rik	T	G	2: 85,494,110	I291L	probably benign	Het
AI182371	A	G	2: 35,085,752	C267R	probably benign	Het
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp8b1	G	A	18: 64,533,721	T1135I	possibly damaging	Het
Avil	T	C	10: 127,008,330	Y253H	probably damaging	Het
Bcas3	G	T	11: 85,801,802	V338L	probably benign	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Ccdc158	T	C	5: 92,610,045	E1056G	probably damaging	Het
Clcn7	T	A	17: 25,159,707	I722N	probably damaging	Het
Cnga3	T	C	1: 37,261,740	Y552H	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp3a25	A	T	5: 145,989,976		probably null	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Eya1	A	G	1: 14,229,501	Y343H	probably damaging	Het
Fbln5	T	C	12: 101,765,252	N228D	probably benign	Het
Fmo5	T	C	3: 97,645,914	F393L	probably damaging	Het
Gpr63	A	G	4: 25,007,993	Y239C	probably damaging	Het
Ints2	T	C	11: 86,243,001	M408V	probably benign	Het
Lztr1	G	A	16: 17,509,061	A12T	possibly damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Obscn	T	C	11: 59,078,395	K2460E	probably damaging	Het
Olfr1179	A	T	2: 88,402,196	I246N	possibly damaging	Het
Olfr1466	T	C	19: 13,342,529	I257T	possibly damaging	Het
Ppfia4	G	T	1: 134,312,567	T896K	probably damaging	Het
Ppp2r2a	C	A	14: 67,019,750	D344Y	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Scn9a	T	G	2: 66,562,405	E281A	probably benign	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syt7	G	T	19: 10,435,636	R265L	possibly damaging	Het
Tub	A	G	7: 109,027,832	S313G	probably benign	Het
Vmn2r18	A	G	5: 151,584,568	F364L	probably benign	Het
Vmn2r77	A	G	7: 86,800,836	N97D	probably damaging	Het
Vmn2r85	A	G	10: 130,418,302	S838P	probably damaging	Het
Vmn2r92	T	A	17: 18,151,943	L5*	probably null	Het
Zfyve28	A	G	5: 34,217,468	F401L	probably damaging	Het

Other mutations in Mutyh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00334:Mutyh	APN	4	116819319	missense	possibly damaging	0.78
IGL02212:Mutyh	APN	4	116815606	missense	probably damaging	1.00
PIT4362001:Mutyh	UTSW	4	116817070	missense	probably damaging	1.00
R1520:Mutyh	UTSW	4	116817552	missense	probably damaging	1.00
R1928:Mutyh	UTSW	4	116816658	missense	probably damaging	1.00
R1987:Mutyh	UTSW	4	116819368	missense	possibly damaging	0.47
R2914:Mutyh	UTSW	4	116815629	missense	probably damaging	0.99
R4722:Mutyh	UTSW	4	116816872	missense	probably damaging	1.00
R4801:Mutyh	UTSW	4	116817029	missense	probably benign	0.17
R4802:Mutyh	UTSW	4	116817029	missense	probably benign	0.17
R4837:Mutyh	UTSW	4	116817690	missense	probably damaging	1.00
R4993:Mutyh	UTSW	4	116817935	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTGACTAGACCCCAGAAAAGGC -3'
(R):5'- TGCTGTACGTGGCATATGGC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GCATATGGCCTCCTAGCTC -3'

Posted On

2015-02-19