Incidental Mutation 'R3694:Mutyh'
ID268897
Institutional Source Beutler Lab
Gene Symbol Mutyh
Ensembl Gene ENSMUSG00000028687
Gene NamemutY DNA glycosylase
SynonymsMutyha, 5730495A01Rik, Mutyhb, Mutyhc, Myh, Mutyhalpha, Mutyhbeta
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location116807723-116819440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 116816454 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 146 (S146T)
Ref Sequence ENSEMBL: ENSMUSP00000099760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055436] [ENSMUST00000102699] [ENSMUST00000130359] [ENSMUST00000155346]
Predicted Effect probably benign
Transcript: ENSMUST00000055436
SMART Domains Protein: ENSMUSP00000062327
Gene: ENSMUSG00000043155

DomainStartEndE-ValueType
SCOP:d1cjxa2 3 144 6e-7 SMART
PDB:1T47|B 4 367 8e-32 PDB
SCOP:d1cjxa2 161 367 5e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102699
AA Change: S146T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099760
Gene: ENSMUSG00000028687
AA Change: S146T

DomainStartEndE-ValueType
ENDO3c 107 259 1.46e-52 SMART
FES 260 280 2.16e-5 SMART
Pfam:NUDIX_4 353 463 2.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124857
Predicted Effect probably benign
Transcript: ENSMUST00000130359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135449
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140680
Predicted Effect unknown
Transcript: ENSMUST00000155346
AA Change: V121D
SMART Domains Protein: ENSMUSP00000122777
Gene: ENSMUSG00000028687
AA Change: V121D

DomainStartEndE-ValueType
PDB:3N5N|Y 50 100 3e-20 PDB
SCOP:d1keaa_ 59 86 3e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA glycosylase involved in oxidative DNA damage repair. The enzyme excises adenine bases from the DNA backbone at sites where adenine is inappropriately paired with guanine, cytosine, or 8-oxo-7,8-dihydroguanine, a major oxidatively damaged DNA lesion. The protein is localized to the nucleus and mitochondria. Mutations in this gene result in heritable predisposition to colon and stomach cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice are viable and show no increase in tumor incidence relative to wild-type through 17 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Mutyh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Mutyh APN 4 116819319 missense possibly damaging 0.78
IGL02212:Mutyh APN 4 116815606 missense probably damaging 1.00
PIT4362001:Mutyh UTSW 4 116817070 missense probably damaging 1.00
R1520:Mutyh UTSW 4 116817552 missense probably damaging 1.00
R1928:Mutyh UTSW 4 116816658 missense probably damaging 1.00
R1987:Mutyh UTSW 4 116819368 missense possibly damaging 0.47
R2914:Mutyh UTSW 4 116815629 missense probably damaging 0.99
R4722:Mutyh UTSW 4 116816872 missense probably damaging 1.00
R4801:Mutyh UTSW 4 116817029 missense probably benign 0.17
R4802:Mutyh UTSW 4 116817029 missense probably benign 0.17
R4837:Mutyh UTSW 4 116817690 missense probably damaging 1.00
R4993:Mutyh UTSW 4 116817935 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGACTAGACCCCAGAAAAGGC -3'
(R):5'- TGCTGTACGTGGCATATGGC -3'

Sequencing Primer
(F):5'- TGGAACTCACTCTGTAGACCAGG -3'
(R):5'- GCATATGGCCTCCTAGCTC -3'
Posted On2015-02-19