Incidental Mutation 'R3694:Magi2'
ID268898
Institutional Source Beutler Lab
Gene Symbol Magi2
Ensembl Gene ENSMUSG00000040003
Gene Namemembrane associated guanylate kinase, WW and PDZ domain containing 2
SynonymsMagi-2, S-SCAM, Acvrinp1
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3694 (G1)
Quality Score187
Status Not validated
Chromosome5
Chromosomal Location19227036-20704792 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) A to AG at 20602461 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146458 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088516] [ENSMUST00000101558] [ENSMUST00000115267] [ENSMUST00000197354] [ENSMUST00000197443] [ENSMUST00000197553] [ENSMUST00000208219]
Predicted Effect probably null
Transcript: ENSMUST00000088516
SMART Domains Protein: ENSMUSP00000085872
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
PDZ 26 101 5.26e-9 SMART
GuKc 107 290 2.76e-45 SMART
WW 302 334 7.43e-12 SMART
WW 348 380 2.4e-6 SMART
PDZ 433 509 3.51e-19 SMART
PDZ 612 682 2.3e-14 SMART
PDZ 785 861 4.04e-19 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 5.05e-20 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 3.88e-21 SMART
low complexity region 1257 1270 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000101558
SMART Domains Protein: ENSMUSP00000099094
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 608 684 4.04e-19 SMART
low complexity region 716 730 N/A INTRINSIC
PDZ 751 832 5.05e-20 SMART
low complexity region 875 886 N/A INTRINSIC
PDZ 970 1044 3.88e-21 SMART
low complexity region 1080 1093 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115267
SMART Domains Protein: ENSMUSP00000110922
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
low complexity region 66 74 N/A INTRINSIC
WW 139 171 7.43e-12 SMART
WW 185 217 2.4e-6 SMART
PDZ 270 346 3.51e-19 SMART
PDZ 449 519 2.3e-14 SMART
PDZ 622 698 4.04e-19 SMART
low complexity region 730 744 N/A INTRINSIC
PDZ 765 846 5.05e-20 SMART
low complexity region 889 900 N/A INTRINSIC
PDZ 984 1058 3.88e-21 SMART
low complexity region 1094 1107 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197354
SMART Domains Protein: ENSMUSP00000142576
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 785 861 2e-21 SMART
low complexity region 893 907 N/A INTRINSIC
PDZ 928 1009 2.4e-22 SMART
low complexity region 1052 1063 N/A INTRINSIC
PDZ 1147 1221 1.9e-23 SMART
low complexity region 1255 1269 N/A INTRINSIC
low complexity region 1304 1319 N/A INTRINSIC
low complexity region 1344 1363 N/A INTRINSIC
low complexity region 1368 1384 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197443
SMART Domains Protein: ENSMUSP00000142764
Gene: ENSMUSG00000040003

DomainStartEndE-ValueType
PDZ 26 101 2.5e-11 SMART
GuKc 107 290 1.4e-47 SMART
WW 302 334 4.3e-14 SMART
WW 348 380 1.4e-8 SMART
PDZ 433 509 1.7e-21 SMART
PDZ 612 682 1.1e-16 SMART
PDZ 771 847 2e-21 SMART
low complexity region 879 893 N/A INTRINSIC
PDZ 914 995 2.4e-22 SMART
low complexity region 1038 1049 N/A INTRINSIC
PDZ 1133 1207 1.9e-23 SMART
low complexity region 1241 1255 N/A INTRINSIC
low complexity region 1290 1305 N/A INTRINSIC
low complexity region 1330 1349 N/A INTRINSIC
low complexity region 1354 1370 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000197553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198908
Predicted Effect probably benign
Transcript: ENSMUST00000199514
Predicted Effect probably null
Transcript: ENSMUST00000208219
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with atrophin-1. Atrophin-1 contains a polyglutamine repeat, expansion of which is responsible for dentatorubral and pallidoluysian atrophy. This encoded protein is characterized by two WW domains, a guanylate kinase-like domain, and multiple PDZ domains. It has structural similarity to the membrane-associated guanylate kinase homologue (MAGUK) family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show neonatal death and hippocampal neurons with altered dendritic spine morphology. Homozygotes for a different null allele die neonatally due to anuria and podocyte anomalies. Mice lacking all three isoforms develop proteinuria, podocytopathy and die of renal failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Magi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00908:Magi2 APN 5 20391301 missense probably benign 0.05
IGL02120:Magi2 APN 5 20228453 critical splice donor site probably null
IGL02341:Magi2 APN 5 20466203 missense probably damaging 1.00
IGL02411:Magi2 APN 5 19678709 missense probably damaging 1.00
IGL02657:Magi2 APN 5 19227583 missense probably damaging 0.99
IGL02976:Magi2 APN 5 20534475 missense probably damaging 1.00
IGL03105:Magi2 APN 5 20543618 missense probably damaging 0.97
IGL03246:Magi2 APN 5 20358950 missense probably damaging 1.00
IGL03329:Magi2 APN 5 20466128 missense possibly damaging 0.95
LCD18:Magi2 UTSW 5 19954511 intron probably benign
PIT4519001:Magi2 UTSW 5 20661346 missense probably damaging 1.00
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0009:Magi2 UTSW 5 20611055 missense probably benign 0.15
R0352:Magi2 UTSW 5 20065666 missense probably damaging 1.00
R0362:Magi2 UTSW 5 19227575 missense probably damaging 1.00
R0496:Magi2 UTSW 5 20661359 splice site probably benign
R1103:Magi2 UTSW 5 20611103 missense probably damaging 1.00
R1435:Magi2 UTSW 5 20358945 missense probably damaging 1.00
R1583:Magi2 UTSW 5 19227332 missense probably benign 0.30
R1616:Magi2 UTSW 5 20609326 missense probably damaging 1.00
R1643:Magi2 UTSW 5 20705506 unclassified probably benign
R1707:Magi2 UTSW 5 20215493 missense probably damaging 1.00
R1833:Magi2 UTSW 5 19227457 missense probably damaging 1.00
R1837:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1838:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1839:Magi2 UTSW 5 20465827 missense probably damaging 1.00
R1847:Magi2 UTSW 5 20602460 missense probably damaging 0.99
R2223:Magi2 UTSW 5 20465672 missense probably damaging 1.00
R2496:Magi2 UTSW 5 19678752 missense probably benign 0.42
R2504:Magi2 UTSW 5 20358936 missense probably damaging 1.00
R2848:Magi2 UTSW 5 20602461 frame shift probably null
R2879:Magi2 UTSW 5 20602461 frame shift probably null
R2935:Magi2 UTSW 5 20602461 frame shift probably null
R2936:Magi2 UTSW 5 20602461 frame shift probably null
R3783:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3786:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3787:Magi2 UTSW 5 20465909 missense probably damaging 0.97
R3837:Magi2 UTSW 5 20215468 missense probably benign 0.28
R4151:Magi2 UTSW 5 19227292 missense probably damaging 0.97
R4721:Magi2 UTSW 5 20534469 missense probably damaging 1.00
R5005:Magi2 UTSW 5 20534446 missense probably damaging 0.98
R5012:Magi2 UTSW 5 20465620 missense probably damaging 0.99
R5193:Magi2 UTSW 5 20358972 critical splice donor site probably null
R5298:Magi2 UTSW 5 20569162 missense probably damaging 1.00
R5372:Magi2 UTSW 5 20702110 missense possibly damaging 0.82
R5580:Magi2 UTSW 5 20215424 missense probably benign 0.03
R5806:Magi2 UTSW 5 20651204 missense probably benign 0.01
R5924:Magi2 UTSW 5 20611069 missense probably benign 0.00
R5992:Magi2 UTSW 5 19227291 start codon destroyed probably null 0.42
R6014:Magi2 UTSW 5 20611093 missense probably damaging 1.00
R6073:Magi2 UTSW 5 20569288 missense probably damaging 1.00
R6500:Magi2 UTSW 5 20602347 missense possibly damaging 0.94
R6664:Magi2 UTSW 5 20702397 missense probably benign 0.00
R7229:Magi2 UTSW 5 20465588 missense probably damaging 1.00
R7344:Magi2 UTSW 5 20550240 missense probably benign 0.19
R7448:Magi2 UTSW 5 20358956 missense probably damaging 1.00
R7605:Magi2 UTSW 5 20228385 missense probably damaging 1.00
R7712:Magi2 UTSW 5 20550282 missense possibly damaging 0.78
R7808:Magi2 UTSW 5 20465840 missense probably benign 0.03
X0065:Magi2 UTSW 5 20569178 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GTTTAGCCTGCTAGGGAAAAGCC -3'
(R):5'- GAAAATCTCCCTCCCATCTGTG -3'

Sequencing Primer
(F):5'- GCACCAAGTCTCAGCCTCTG -3'
(R):5'- GTGTCCTAAACGGTTCTCAGGAATTC -3'
Posted On2015-02-19