Incidental Mutation 'R3694:Zfyve28'
ID268899
Institutional Source Beutler Lab
Gene Symbol Zfyve28
Ensembl Gene ENSMUSG00000037224
Gene Namezinc finger, FYVE domain containing 28
Synonyms9630058O20Rik
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34194893-34288449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34217468 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 401 (F401L)
Ref Sequence ENSEMBL: ENSMUSP00000092464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094868]
Predicted Effect probably damaging
Transcript: ENSMUST00000094868
AA Change: F401L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: F401L

DomainStartEndE-ValueType
low complexity region 718 730 N/A INTRINSIC
FYVE 827 896 8.73e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114370
SMART Domains Protein: ENSMUSP00000110010
Gene: ENSMUSG00000037224

DomainStartEndE-ValueType
coiled coil region 310 344 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132104
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140646
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201477
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Other mutations in Zfyve28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Zfyve28 APN 5 34243195 missense probably damaging 0.98
IGL02201:Zfyve28 APN 5 34243205 missense probably damaging 1.00
PIT4418001:Zfyve28 UTSW 5 34233377 missense probably damaging 1.00
R0499:Zfyve28 UTSW 5 34232206 missense possibly damaging 0.65
R1226:Zfyve28 UTSW 5 34217064 missense probably benign 0.00
R1290:Zfyve28 UTSW 5 34198801 missense probably benign 0.00
R1351:Zfyve28 UTSW 5 34232205 missense probably damaging 1.00
R1418:Zfyve28 UTSW 5 34217246 missense probably damaging 0.99
R2062:Zfyve28 UTSW 5 34234337 missense probably null 0.73
R2212:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R2443:Zfyve28 UTSW 5 34216894 missense possibly damaging 0.64
R2851:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R2852:Zfyve28 UTSW 5 34196662 missense probably damaging 1.00
R3412:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R3413:Zfyve28 UTSW 5 34199684 missense probably benign 0.02
R4645:Zfyve28 UTSW 5 34222443 intron probably benign
R4700:Zfyve28 UTSW 5 34217845 missense probably damaging 1.00
R4938:Zfyve28 UTSW 5 34233354 missense probably damaging 0.99
R5384:Zfyve28 UTSW 5 34216967 missense probably damaging 1.00
R5908:Zfyve28 UTSW 5 34216870 missense possibly damaging 0.62
R5936:Zfyve28 UTSW 5 34224988 missense probably damaging 1.00
R6260:Zfyve28 UTSW 5 34198872 missense probably damaging 0.99
R6862:Zfyve28 UTSW 5 34288105 missense probably benign 0.10
R7172:Zfyve28 UTSW 5 34234409 missense probably benign 0.42
R7243:Zfyve28 UTSW 5 34198875 missense probably damaging 1.00
R7366:Zfyve28 UTSW 5 34232227 missense probably damaging 1.00
R7598:Zfyve28 UTSW 5 34236117 missense probably damaging 1.00
R7654:Zfyve28 UTSW 5 34243195 missense probably damaging 1.00
R7752:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R7861:Zfyve28 UTSW 5 34217143 missense probably damaging 1.00
R7878:Zfyve28 UTSW 5 34199655 missense probably damaging 1.00
R7901:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
R7944:Zfyve28 UTSW 5 34217143 missense probably damaging 1.00
R7961:Zfyve28 UTSW 5 34199655 missense probably damaging 1.00
R7984:Zfyve28 UTSW 5 34224982 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGAGCTGTGAGTCTAGGCAG -3'
(R):5'- CAGAACTGGCCTGCTCAATG -3'

Sequencing Primer
(F):5'- TGAGTCTAGGCAGCTGCAG -3'
(R):5'- GCTCAATGCAGTATGATGATCAG -3'
Posted On2015-02-19