Mutagenetix > Incidental Mutations

Incidental Mutation 'R3694:Zfyve28'

268899

Institutional Source

Beutler Lab

Gene Symbol

Zfyve28

Ensembl Gene

ENSMUSG00000037224

Gene Name

zinc finger, FYVE domain containing 28

Synonyms

9630058O20Rik

MMRRC Submission

040689-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34194893-34288449 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34217468 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 401 (F401L)

Ref Sequence

ENSEMBL: ENSMUSP00000092464 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094868]

Predicted Effect

probably damaging
Transcript: ENSMUST00000094868
AA Change: F401L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000092464
Gene: ENSMUSG00000037224
AA Change: F401L

Domain	Start	End	E-Value	Type
low complexity region	718	730	N/A	INTRINSIC
FYVE	827	896	8.73e-25	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000114370

SMART Domains

Protein: ENSMUSP00000110010
Gene: ENSMUSG00000037224

Domain	Start	End	E-Value	Type
coiled coil region	310	344	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130435

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132104

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140646

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201477

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,550,516	I97V	possibly damaging	Het
4833423E24Rik	T	G	2: 85,494,110	I291L	probably benign	Het
AI182371	A	G	2: 35,085,752	C267R	probably benign	Het
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp8b1	G	A	18: 64,533,721	T1135I	possibly damaging	Het
Avil	T	C	10: 127,008,330	Y253H	probably damaging	Het
Bcas3	G	T	11: 85,801,802	V338L	probably benign	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Ccdc158	T	C	5: 92,610,045	E1056G	probably damaging	Het
Clcn7	T	A	17: 25,159,707	I722N	probably damaging	Het
Cnga3	T	C	1: 37,261,740	Y552H	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp3a25	A	T	5: 145,989,976		probably null	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Eya1	A	G	1: 14,229,501	Y343H	probably damaging	Het
Fbln5	T	C	12: 101,765,252	N228D	probably benign	Het
Fmo5	T	C	3: 97,645,914	F393L	probably damaging	Het
Gpr63	A	G	4: 25,007,993	Y239C	probably damaging	Het
Ints2	T	C	11: 86,243,001	M408V	probably benign	Het
Lztr1	G	A	16: 17,509,061	A12T	possibly damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Mutyh	T	A	4: 116,816,454	S146T	possibly damaging	Het
Obscn	T	C	11: 59,078,395	K2460E	probably damaging	Het
Olfr1179	A	T	2: 88,402,196	I246N	possibly damaging	Het
Olfr1466	T	C	19: 13,342,529	I257T	possibly damaging	Het
Ppfia4	G	T	1: 134,312,567	T896K	probably damaging	Het
Ppp2r2a	C	A	14: 67,019,750	D344Y	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Scn9a	T	G	2: 66,562,405	E281A	probably benign	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syt7	G	T	19: 10,435,636	R265L	possibly damaging	Het
Tub	A	G	7: 109,027,832	S313G	probably benign	Het
Vmn2r18	A	G	5: 151,584,568	F364L	probably benign	Het
Vmn2r77	A	G	7: 86,800,836	N97D	probably damaging	Het
Vmn2r85	A	G	10: 130,418,302	S838P	probably damaging	Het
Vmn2r92	T	A	17: 18,151,943	L5*	probably null	Het

Other mutations in Zfyve28

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00497:Zfyve28	APN	5	34243195	missense	probably damaging	0.98
IGL02201:Zfyve28	APN	5	34243205	missense	probably damaging	1.00
PIT4418001:Zfyve28	UTSW	5	34233377	missense	probably damaging	1.00
R0499:Zfyve28	UTSW	5	34232206	missense	possibly damaging	0.65
R1226:Zfyve28	UTSW	5	34217064	missense	probably benign	0.00
R1290:Zfyve28	UTSW	5	34198801	missense	probably benign	0.00
R1351:Zfyve28	UTSW	5	34232205	missense	probably damaging	1.00
R1418:Zfyve28	UTSW	5	34217246	missense	probably damaging	0.99
R2062:Zfyve28	UTSW	5	34234337	missense	probably null	0.73
R2212:Zfyve28	UTSW	5	34199684	missense	probably benign	0.02
R2443:Zfyve28	UTSW	5	34216894	missense	possibly damaging	0.64
R2851:Zfyve28	UTSW	5	34196662	missense	probably damaging	1.00
R2852:Zfyve28	UTSW	5	34196662	missense	probably damaging	1.00
R3412:Zfyve28	UTSW	5	34199684	missense	probably benign	0.02
R3413:Zfyve28	UTSW	5	34199684	missense	probably benign	0.02
R4645:Zfyve28	UTSW	5	34222443	intron	probably benign
R4700:Zfyve28	UTSW	5	34217845	missense	probably damaging	1.00
R4938:Zfyve28	UTSW	5	34233354	missense	probably damaging	0.99
R5384:Zfyve28	UTSW	5	34216967	missense	probably damaging	1.00
R5908:Zfyve28	UTSW	5	34216870	missense	possibly damaging	0.62
R5936:Zfyve28	UTSW	5	34224988	missense	probably damaging	1.00
R6260:Zfyve28	UTSW	5	34198872	missense	probably damaging	0.99
R6862:Zfyve28	UTSW	5	34288105	missense	probably benign	0.10
R7172:Zfyve28	UTSW	5	34234409	missense	probably benign	0.42
R7243:Zfyve28	UTSW	5	34198875	missense	probably damaging	1.00
R7366:Zfyve28	UTSW	5	34232227	missense	probably damaging	1.00
R7598:Zfyve28	UTSW	5	34236117	missense	probably damaging	1.00
R7654:Zfyve28	UTSW	5	34243195	missense	probably damaging	1.00
R7752:Zfyve28	UTSW	5	34224982	missense	probably damaging	1.00
R7861:Zfyve28	UTSW	5	34217143	missense	probably damaging	1.00
R7878:Zfyve28	UTSW	5	34199655	missense	probably damaging	1.00
R7901:Zfyve28	UTSW	5	34224982	missense	probably damaging	1.00
R8116:Zfyve28	UTSW	5	34217600	missense	probably damaging	0.96
R8483:Zfyve28	UTSW	5	34236136	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- GTAGAGCTGTGAGTCTAGGCAG -3'
(R):5'- CAGAACTGGCCTGCTCAATG -3'

Sequencing Primer
(F):5'- TGAGTCTAGGCAGCTGCAG -3'
(R):5'- GCTCAATGCAGTATGATGATCAG -3'

Posted On

2015-02-19