Incidental Mutation 'R3694:Vmn2r18'
ID268902
Institutional Source Beutler Lab
Gene Symbol Vmn2r18
Ensembl Gene ENSMUSG00000091794
Gene Namevomeronasal 2, receptor 18
SynonymsEG632671
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location151561661-151586906 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 151584568 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 364 (F364L)
Ref Sequence ENSEMBL: ENSMUSP00000127506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165928]
Predicted Effect probably benign
Transcript: ENSMUST00000165928
AA Change: F364L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127506
Gene: ENSMUSG00000091794
AA Change: F364L

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 403 5.7e-39 PFAM
Pfam:NCD3G 446 499 5.5e-20 PFAM
Pfam:7tm_3 531 767 5e-53 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Vmn2r18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Vmn2r18 APN 5 151572831 missense probably damaging 0.99
IGL01564:Vmn2r18 APN 5 151585168 missense possibly damaging 0.69
IGL01602:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01605:Vmn2r18 APN 5 151586641 missense possibly damaging 0.64
IGL01619:Vmn2r18 APN 5 151586764 missense probably benign 0.25
IGL02177:Vmn2r18 APN 5 151586809 missense possibly damaging 0.76
IGL02682:Vmn2r18 APN 5 151584637 missense probably damaging 0.99
IGL02751:Vmn2r18 APN 5 151584607 missense probably benign 0.09
IGL02977:Vmn2r18 APN 5 151586684 missense probably damaging 1.00
R0089:Vmn2r18 UTSW 5 151584804 missense probably benign 0.00
R0282:Vmn2r18 UTSW 5 151585203 missense probably benign 0.02
R0529:Vmn2r18 UTSW 5 151562523 missense probably damaging 0.99
R0812:Vmn2r18 UTSW 5 151572930 splice site probably benign
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1467:Vmn2r18 UTSW 5 151586836 missense possibly damaging 0.48
R1506:Vmn2r18 UTSW 5 151575634 intron probably null
R1562:Vmn2r18 UTSW 5 151586836 missense probably benign 0.12
R1637:Vmn2r18 UTSW 5 151584757 missense probably damaging 1.00
R1651:Vmn2r18 UTSW 5 151561999 missense probably damaging 1.00
R1883:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1884:Vmn2r18 UTSW 5 151575725 missense probably benign 0.37
R1914:Vmn2r18 UTSW 5 151575821 missense probably benign 0.02
R2051:Vmn2r18 UTSW 5 151562551 missense possibly damaging 0.90
R2056:Vmn2r18 UTSW 5 151584695 missense probably damaging 0.98
R2252:Vmn2r18 UTSW 5 151584976 missense possibly damaging 0.59
R2265:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2266:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2267:Vmn2r18 UTSW 5 151586662 missense probably damaging 1.00
R2843:Vmn2r18 UTSW 5 151562284 missense probably damaging 1.00
R3023:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R3763:Vmn2r18 UTSW 5 151585179 missense probably damaging 1.00
R3816:Vmn2r18 UTSW 5 151561683 missense probably benign 0.13
R4007:Vmn2r18 UTSW 5 151585246 missense probably damaging 0.99
R4152:Vmn2r18 UTSW 5 151562265 missense probably damaging 1.00
R4308:Vmn2r18 UTSW 5 151584803 nonsense probably null
R4362:Vmn2r18 UTSW 5 151572903 missense probably damaging 1.00
R4618:Vmn2r18 UTSW 5 151584959 missense possibly damaging 0.64
R4716:Vmn2r18 UTSW 5 151562137 missense possibly damaging 0.87
R4817:Vmn2r18 UTSW 5 151585432 intron probably null
R5111:Vmn2r18 UTSW 5 151562448 missense possibly damaging 0.85
R5692:Vmn2r18 UTSW 5 151562259 missense possibly damaging 0.65
R6115:Vmn2r18 UTSW 5 151584997 missense possibly damaging 0.81
R6244:Vmn2r18 UTSW 5 151584651 missense probably damaging 1.00
R6595:Vmn2r18 UTSW 5 151562424 missense probably damaging 1.00
R6997:Vmn2r18 UTSW 5 151561873 missense possibly damaging 0.95
R7227:Vmn2r18 UTSW 5 151572799 missense probably damaging 1.00
R7349:Vmn2r18 UTSW 5 151562217 nonsense probably null
R7506:Vmn2r18 UTSW 5 151585020 missense possibly damaging 0.51
R7590:Vmn2r18 UTSW 5 151561729 missense probably damaging 1.00
R7721:Vmn2r18 UTSW 5 151586693 missense possibly damaging 0.53
R7877:Vmn2r18 UTSW 5 151584972 missense probably damaging 1.00
R7882:Vmn2r18 UTSW 5 151561864 missense probably damaging 1.00
R7960:Vmn2r18 UTSW 5 151584972 missense probably damaging 1.00
R7965:Vmn2r18 UTSW 5 151561864 missense probably damaging 1.00
Z1176:Vmn2r18 UTSW 5 151585033 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCACCATTATTTCAGGCACATACAC -3'
(R):5'- GACAAGTTTGATTGCGCACCTC -3'

Sequencing Primer
(F):5'- TATTTCAGGCACATACACACCCATTG -3'
(R):5'- CTATGTGGAAGGAATAAACCCTGTCC -3'
Posted On2015-02-19