Incidental Mutation 'R3694:2900092C05Rik'
ID268903
Institutional Source Beutler Lab
Gene Symbol 2900092C05Rik
Ensembl Gene ENSMUSG00000030385
Gene NameRIKEN cDNA 2900092C05 gene
Synonyms
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location12512517-12556323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12550516 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 97 (I97V)
Ref Sequence ENSEMBL: ENSMUSP00000032541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032541]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032541
AA Change: I97V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032541
Gene: ENSMUSG00000030385
AA Change: I97V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in 2900092C05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00714:2900092C05Rik APN 7 12556004 splice site probably benign
IGL01744:2900092C05Rik APN 7 12550532 missense possibly damaging 0.92
IGL03047:2900092C05Rik UTSW 7 12512641 missense possibly damaging 0.92
R0001:2900092C05Rik UTSW 7 12554607 splice site probably benign
R0607:2900092C05Rik UTSW 7 12554698 missense probably benign 0.19
R0831:2900092C05Rik UTSW 7 12550596 splice site probably benign
R1468:2900092C05Rik UTSW 7 12512580 start codon destroyed probably null 0.83
R1468:2900092C05Rik UTSW 7 12512580 start codon destroyed probably null 0.83
R1846:2900092C05Rik UTSW 7 12512882 missense probably benign 0.38
R1852:2900092C05Rik UTSW 7 12512702 splice site probably null
R1912:2900092C05Rik UTSW 7 12554655 missense probably benign 0.01
R3442:2900092C05Rik UTSW 7 12512656 nonsense probably null
R3751:2900092C05Rik UTSW 7 12556046 missense probably benign 0.02
R5977:2900092C05Rik UTSW 7 12554737 missense probably benign 0.17
R6158:2900092C05Rik UTSW 7 12512672 missense probably benign 0.37
R6777:2900092C05Rik UTSW 7 12512829 missense probably benign 0.00
R6931:2900092C05Rik UTSW 7 12512596 missense unknown
R7284:2900092C05Rik UTSW 7 12512678 nonsense probably null
R7406:2900092C05Rik UTSW 7 12515464 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- CTCAACTAGACAATGTACAGAGAGG -3'
(R):5'- TGTGACCTAACAATGAGCAATCCC -3'

Sequencing Primer
(F):5'- GGGGAGACTTTGGAGCCCTC -3'
(R):5'- GAGCAATCCCACCAAATCTTCTATTC -3'
Posted On2015-02-19