Mutagenetix > Incidental Mutation

Incidental Mutation 'R3694:Vmn2r77'

268905

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r77

Ensembl Gene

ENSMUSG00000090949

Gene Name

vomeronasal 2, receptor 77

Synonyms

EG546983

MMRRC Submission

040689-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R3694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86795141-86812032 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 86800836 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 97 (N97D)

Ref Sequence

ENSEMBL: ENSMUSP00000129540 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000164996]

AlphaFold

L7N2B7

Predicted Effect

probably damaging
Transcript: ENSMUST00000164996
AA Change: N97D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: N97D

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	78	467	1.4e-30	PFAM
Pfam:NCD3G	510	562	1e-20	PFAM
Pfam:7tm_3	594	830	2.6e-52	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,550,516	I97V	possibly damaging	Het
4833423E24Rik	T	G	2: 85,494,110	I291L	probably benign	Het
AI182371	A	G	2: 35,085,752	C267R	probably benign	Het
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp8b1	G	A	18: 64,533,721	T1135I	possibly damaging	Het
Avil	T	C	10: 127,008,330	Y253H	probably damaging	Het
Bcas3	G	T	11: 85,801,802	V338L	probably benign	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Ccdc158	T	C	5: 92,610,045	E1056G	probably damaging	Het
Clcn7	T	A	17: 25,159,707	I722N	probably damaging	Het
Cnga3	T	C	1: 37,261,740	Y552H	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp3a25	A	T	5: 145,989,976		probably null	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Eya1	A	G	1: 14,229,501	Y343H	probably damaging	Het
Fbln5	T	C	12: 101,765,252	N228D	probably benign	Het
Fmo5	T	C	3: 97,645,914	F393L	probably damaging	Het
Gpr63	A	G	4: 25,007,993	Y239C	probably damaging	Het
Ints2	T	C	11: 86,243,001	M408V	probably benign	Het
Lztr1	G	A	16: 17,509,061	A12T	possibly damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Mutyh	T	A	4: 116,816,454	S146T	possibly damaging	Het
Obscn	T	C	11: 59,078,395	K2460E	probably damaging	Het
Olfr1179	A	T	2: 88,402,196	I246N	possibly damaging	Het
Olfr1466	T	C	19: 13,342,529	I257T	possibly damaging	Het
Ppfia4	G	T	1: 134,312,567	T896K	probably damaging	Het
Ppp2r2a	C	A	14: 67,019,750	D344Y	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Scn9a	T	G	2: 66,562,405	E281A	probably benign	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syt7	G	T	19: 10,435,636	R265L	possibly damaging	Het
Tub	A	G	7: 109,027,832	S313G	probably benign	Het
Vmn2r18	A	G	5: 151,584,568	F364L	probably benign	Het
Vmn2r85	A	G	10: 130,418,302	S838P	probably damaging	Het
Vmn2r92	T	A	17: 18,151,943	L5*	probably null	Het
Zfyve28	A	G	5: 34,217,468	F401L	probably damaging	Het

Other mutations in Vmn2r77

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00954:Vmn2r77	APN	7	86800767	missense	probably benign	0.06
IGL01105:Vmn2r77	APN	7	86811664	missense	probably damaging	0.99
IGL01367:Vmn2r77	APN	7	86811916	missense	probably damaging	0.98
IGL01634:Vmn2r77	APN	7	86811649	missense	probably benign
IGL01805:Vmn2r77	APN	7	86811187	missense	probably benign	0.18
IGL01868:Vmn2r77	APN	7	86803016	missense	probably benign	0.00
IGL01980:Vmn2r77	APN	7	86801470	missense	probably benign	0.14
IGL02055:Vmn2r77	APN	7	86801555	missense	probably benign	0.00
IGL02066:Vmn2r77	APN	7	86803628	nonsense	probably null
IGL02185:Vmn2r77	APN	7	86795152	missense	unknown
IGL02200:Vmn2r77	APN	7	86801979	missense	probably benign	0.04
IGL02336:Vmn2r77	APN	7	86802016	missense	probably damaging	0.99
IGL02445:Vmn2r77	APN	7	86803640	nonsense	probably null
IGL02557:Vmn2r77	APN	7	86795134	unclassified	probably benign
IGL02659:Vmn2r77	APN	7	86800771	missense	probably benign	0.32
IGL02978:Vmn2r77	APN	7	86811347	missense	probably benign
IGL03180:Vmn2r77	APN	7	86801635	missense	possibly damaging	0.85
IGL03255:Vmn2r77	APN	7	86811923	missense	probably benign	0.04
IGL03273:Vmn2r77	APN	7	86811286	missense	probably damaging	0.99
R0046:Vmn2r77	UTSW	7	86801938	missense	possibly damaging	0.73
R0047:Vmn2r77	UTSW	7	86811650	missense	probably benign	0.01
R0066:Vmn2r77	UTSW	7	86800756	missense	probably benign	0.17
R0066:Vmn2r77	UTSW	7	86800756	missense	probably benign	0.17
R0389:Vmn2r77	UTSW	7	86801494	missense	probably benign	0.29
R0635:Vmn2r77	UTSW	7	86811175	missense	probably benign
R0689:Vmn2r77	UTSW	7	86811664	missense	probably damaging	0.99
R0827:Vmn2r77	UTSW	7	86802016	missense	probably damaging	1.00
R1167:Vmn2r77	UTSW	7	86801746	missense	probably benign	0.02
R1228:Vmn2r77	UTSW	7	86801034	critical splice donor site	probably null
R1353:Vmn2r77	UTSW	7	86802186	missense	probably benign	0.29
R1392:Vmn2r77	UTSW	7	86801622	missense	probably benign	0.00
R1392:Vmn2r77	UTSW	7	86801622	missense	probably benign	0.00
R1613:Vmn2r77	UTSW	7	86811148	missense	probably damaging	1.00
R1654:Vmn2r77	UTSW	7	86811915	missense	probably damaging	1.00
R1742:Vmn2r77	UTSW	7	86795335	missense	probably benign	0.35
R1827:Vmn2r77	UTSW	7	86801613	missense	probably damaging	0.99
R1911:Vmn2r77	UTSW	7	86811793	missense	probably damaging	1.00
R1974:Vmn2r77	UTSW	7	86800756	missense	probably benign	0.17
R2008:Vmn2r77	UTSW	7	86801713	missense	probably benign	0.31
R2093:Vmn2r77	UTSW	7	86801494	missense	probably benign	0.29
R2143:Vmn2r77	UTSW	7	86811944	missense	probably damaging	1.00
R2269:Vmn2r77	UTSW	7	86811689	missense	probably benign	0.03
R2972:Vmn2r77	UTSW	7	86803685	missense	probably benign	0.01
R2974:Vmn2r77	UTSW	7	86803685	missense	probably benign	0.01
R3037:Vmn2r77	UTSW	7	86800983	missense	probably benign
R3695:Vmn2r77	UTSW	7	86800836	missense	probably damaging	1.00
R3805:Vmn2r77	UTSW	7	86795160	nonsense	probably null
R3870:Vmn2r77	UTSW	7	86811842	missense	probably damaging	1.00
R4732:Vmn2r77	UTSW	7	86800987	missense	probably benign	0.00
R4733:Vmn2r77	UTSW	7	86800987	missense	probably benign	0.00
R5009:Vmn2r77	UTSW	7	86801807	missense	possibly damaging	0.82
R5201:Vmn2r77	UTSW	7	86811638	missense	probably damaging	0.98
R5218:Vmn2r77	UTSW	7	86802133	missense	probably damaging	0.98
R5469:Vmn2r77	UTSW	7	86802063	missense	probably benign	0.01
R5673:Vmn2r77	UTSW	7	86812006	missense	probably benign	0.05
R5771:Vmn2r77	UTSW	7	86812027	missense	probably benign	0.06
R5832:Vmn2r77	UTSW	7	86811462	nonsense	probably null
R5899:Vmn2r77	UTSW	7	86811716	missense	probably damaging	1.00
R6151:Vmn2r77	UTSW	7	86801670	missense	probably benign	0.00
R6182:Vmn2r77	UTSW	7	86811749	missense	probably damaging	1.00
R6326:Vmn2r77	UTSW	7	86801823	missense	probably benign
R6419:Vmn2r77	UTSW	7	86811559	missense	probably damaging	0.99
R6549:Vmn2r77	UTSW	7	86800857	missense	probably benign	0.06
R6874:Vmn2r77	UTSW	7	86802078	missense	probably benign	0.00
R6972:Vmn2r77	UTSW	7	86802994	missense	probably damaging	1.00
R7056:Vmn2r77	UTSW	7	86801815	missense	probably benign	0.06
R7185:Vmn2r77	UTSW	7	86801827	missense	probably benign	0.00
R7261:Vmn2r77	UTSW	7	86811310	nonsense	probably null
R7298:Vmn2r77	UTSW	7	86800771	missense	probably benign	0.00
R7662:Vmn2r77	UTSW	7	86811284	nonsense	probably null
R8182:Vmn2r77	UTSW	7	86811593	missense	probably damaging	1.00
R8327:Vmn2r77	UTSW	7	86801472	missense	probably benign	0.08
R8387:Vmn2r77	UTSW	7	86801739	missense	probably benign	0.00
R8825:Vmn2r77	UTSW	7	86803647	missense	probably benign
R8898:Vmn2r77	UTSW	7	86795222	missense	probably damaging	1.00
R8973:Vmn2r77	UTSW	7	86802942	missense	possibly damaging	0.93
R9258:Vmn2r77	UTSW	7	86803094	missense	possibly damaging	0.88
R9338:Vmn2r77	UTSW	7	86811786	missense	probably damaging	1.00
R9358:Vmn2r77	UTSW	7	86803028	missense	probably benign	0.00
R9377:Vmn2r77	UTSW	7	86795234	missense	probably benign	0.05
R9404:Vmn2r77	UTSW	7	86802039	missense	probably benign
R9673:Vmn2r77	UTSW	7	86800963	missense	possibly damaging	0.75
R9679:Vmn2r77	UTSW	7	86811533	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- CTGTATCAACATGTAAAAGGGTCAC -3'
(R):5'- TTGGTACTCAGAAATCCATACTGTG -3'

Sequencing Primer
(F):5'- ACATGTAAAAGGGTCACAAAAATCC -3'
(R):5'- TTCTAGAGAAGTACAGAAATGGTCC -3'

Posted On

2015-02-19