Incidental Mutation 'R3694:Tub'
ID268906
Institutional Source Beutler Lab
Gene Symbol Tub
Ensembl Gene ENSMUSG00000031028
Gene Nametubby bipartite transcription factor
Synonymsrd5, tub
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108950338-109034460 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109027832 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 313 (S313G)
Ref Sequence ENSEMBL: ENSMUSP00000113580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474]
Predicted Effect probably benign
Transcript: ENSMUST00000033341
AA Change: S359G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: S359G

DomainStartEndE-ValueType
Pfam:Tub_N 29 237 2.5e-58 PFAM
Pfam:Tub 257 499 2.4e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119474
AA Change: S313G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: S313G

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 55 77 N/A INTRINSIC
low complexity region 145 174 N/A INTRINSIC
low complexity region 183 196 N/A INTRINSIC
Pfam:Tub 211 453 2.4e-121 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147943
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Tub
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01694:Tub APN 7 109021036 splice site probably benign
IGL02715:Tub APN 7 109029310 missense probably benign
grasso UTSW 7 109029650 missense probably damaging 1.00
troy UTSW 7 109020954 nonsense probably null
R0152:Tub UTSW 7 109020927 missense probably damaging 1.00
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0233:Tub UTSW 7 109029341 missense possibly damaging 0.63
R0317:Tub UTSW 7 109020927 missense probably damaging 1.00
R1382:Tub UTSW 7 109030153 missense probably damaging 1.00
R1395:Tub UTSW 7 109020954 nonsense probably null
R1588:Tub UTSW 7 109029681 missense probably damaging 1.00
R1975:Tub UTSW 7 109027835 missense possibly damaging 0.74
R2047:Tub UTSW 7 109026732 missense probably benign 0.30
R2121:Tub UTSW 7 109026737 missense probably damaging 1.00
R2414:Tub UTSW 7 109027033 missense probably damaging 1.00
R3695:Tub UTSW 7 109027832 missense probably benign
R4914:Tub UTSW 7 109020954 nonsense probably null
R5139:Tub UTSW 7 109011102 start codon destroyed probably null 0.53
R5347:Tub UTSW 7 109026771 missense possibly damaging 0.67
R5557:Tub UTSW 7 109025718 missense probably damaging 0.99
R6000:Tub UTSW 7 109029650 missense probably damaging 1.00
R6245:Tub UTSW 7 109027058 missense probably damaging 1.00
R6888:Tub UTSW 7 109029298 missense probably null 1.00
R7316:Tub UTSW 7 109030171 missense possibly damaging 0.69
RF005:Tub UTSW 7 109022639 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCCACTGTGTTCCCAGG -3'
(R):5'- TGAAGACAGGTTAAGGTCTAGTC -3'

Sequencing Primer
(F):5'- GCCCATGCCATGAATGCTGTG -3'
(R):5'- GGTTAAGGTCTAGTCCCACACAG -3'
Posted On2015-02-19