Mutagenetix > Incidental Mutations

Incidental Mutation 'R3694:Tub'

268906

Institutional Source

Beutler Lab

Gene Symbol

Tub

Ensembl Gene

ENSMUSG00000031028

Gene Name

tubby bipartite transcription factor

Synonyms

rd5, tub

MMRRC Submission

040689-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108950338-109034460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 109027832 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 313 (S313G)

Ref Sequence

ENSEMBL: ENSMUSP00000113580 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033341] [ENSMUST00000119474]

Predicted Effect

probably benign
Transcript: ENSMUST00000033341
AA Change: S359G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000033341
Gene: ENSMUSG00000031028
AA Change: S359G

Domain	Start	End	E-Value	Type
Pfam:Tub_N	29	237	2.5e-58	PFAM
Pfam:Tub	257	499	2.4e-88	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000119474
AA Change: S313G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000113580
Gene: ENSMUSG00000031028
AA Change: S313G

Domain	Start	End	E-Value	Type
low complexity region	24	41	N/A	INTRINSIC
low complexity region	55	77	N/A	INTRINSIC
low complexity region	145	174	N/A	INTRINSIC
low complexity region	183	196	N/A	INTRINSIC
Pfam:Tub	211	453	2.4e-121	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147943

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Tubby family of bipartite transcription factors. The encoded protein may play a role in obesity and sensorineural degradation. The crystal structure has been determined for a similar protein in mouse, and it functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit a late-developing obesity with hyperinsulinemia, retinal degeneration, and hearing loss associated with death of both outer and inner hair cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,550,516	I97V	possibly damaging	Het
4833423E24Rik	T	G	2: 85,494,110	I291L	probably benign	Het
AI182371	A	G	2: 35,085,752	C267R	probably benign	Het
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp8b1	G	A	18: 64,533,721	T1135I	possibly damaging	Het
Avil	T	C	10: 127,008,330	Y253H	probably damaging	Het
Bcas3	G	T	11: 85,801,802	V338L	probably benign	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Ccdc158	T	C	5: 92,610,045	E1056G	probably damaging	Het
Clcn7	T	A	17: 25,159,707	I722N	probably damaging	Het
Cnga3	T	C	1: 37,261,740	Y552H	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp3a25	A	T	5: 145,989,976		probably null	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Eya1	A	G	1: 14,229,501	Y343H	probably damaging	Het
Fbln5	T	C	12: 101,765,252	N228D	probably benign	Het
Fmo5	T	C	3: 97,645,914	F393L	probably damaging	Het
Gpr63	A	G	4: 25,007,993	Y239C	probably damaging	Het
Ints2	T	C	11: 86,243,001	M408V	probably benign	Het
Lztr1	G	A	16: 17,509,061	A12T	possibly damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Mutyh	T	A	4: 116,816,454	S146T	possibly damaging	Het
Obscn	T	C	11: 59,078,395	K2460E	probably damaging	Het
Olfr1179	A	T	2: 88,402,196	I246N	possibly damaging	Het
Olfr1466	T	C	19: 13,342,529	I257T	possibly damaging	Het
Ppfia4	G	T	1: 134,312,567	T896K	probably damaging	Het
Ppp2r2a	C	A	14: 67,019,750	D344Y	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Scn9a	T	G	2: 66,562,405	E281A	probably benign	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syt7	G	T	19: 10,435,636	R265L	possibly damaging	Het
Vmn2r18	A	G	5: 151,584,568	F364L	probably benign	Het
Vmn2r77	A	G	7: 86,800,836	N97D	probably damaging	Het
Vmn2r85	A	G	10: 130,418,302	S838P	probably damaging	Het
Vmn2r92	T	A	17: 18,151,943	L5*	probably null	Het
Zfyve28	A	G	5: 34,217,468	F401L	probably damaging	Het

Other mutations in Tub

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01694:Tub	APN	7	109021036	splice site	probably benign
IGL02715:Tub	APN	7	109029310	missense	probably benign
grasso	UTSW	7	109029650	missense	probably damaging	1.00
troy	UTSW	7	109020954	nonsense	probably null
R0152:Tub	UTSW	7	109020927	missense	probably damaging	1.00
R0233:Tub	UTSW	7	109029341	missense	possibly damaging	0.63
R0233:Tub	UTSW	7	109029341	missense	possibly damaging	0.63
R0317:Tub	UTSW	7	109020927	missense	probably damaging	1.00
R1382:Tub	UTSW	7	109030153	missense	probably damaging	1.00
R1395:Tub	UTSW	7	109020954	nonsense	probably null
R1588:Tub	UTSW	7	109029681	missense	probably damaging	1.00
R1975:Tub	UTSW	7	109027835	missense	possibly damaging	0.74
R2047:Tub	UTSW	7	109026732	missense	probably benign	0.30
R2121:Tub	UTSW	7	109026737	missense	probably damaging	1.00
R2414:Tub	UTSW	7	109027033	missense	probably damaging	1.00
R3695:Tub	UTSW	7	109027832	missense	probably benign
R4914:Tub	UTSW	7	109020954	nonsense	probably null
R5139:Tub	UTSW	7	109011102	start codon destroyed	probably null	0.53
R5347:Tub	UTSW	7	109026771	missense	possibly damaging	0.67
R5557:Tub	UTSW	7	109025718	missense	probably damaging	0.99
R6000:Tub	UTSW	7	109029650	missense	probably damaging	1.00
R6245:Tub	UTSW	7	109027058	missense	probably damaging	1.00
R6888:Tub	UTSW	7	109029298	missense	probably null	1.00
R7316:Tub	UTSW	7	109030171	missense	possibly damaging	0.69
RF005:Tub	UTSW	7	109022639	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- ACTTCCACTGTGTTCCCAGG -3'
(R):5'- TGAAGACAGGTTAAGGTCTAGTC -3'

Sequencing Primer
(F):5'- GCCCATGCCATGAATGCTGTG -3'
(R):5'- GGTTAAGGTCTAGTCCCACACAG -3'

Posted On

2015-02-19