Incidental Mutation 'R3694:Avil'
ID268909
Institutional Source Beutler Lab
Gene Symbol Avil
Ensembl Gene ENSMUSG00000025432
Gene Nameadvillin
SynonymsDOC6
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location127000709-127020994 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127008330 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 253 (Y253H)
Ref Sequence ENSEMBL: ENSMUSP00000123405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026500] [ENSMUST00000126816] [ENSMUST00000129173] [ENSMUST00000142698] [ENSMUST00000152054]
Predicted Effect probably benign
Transcript: ENSMUST00000026500
AA Change: Y253H

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026500
Gene: ENSMUSG00000025432
AA Change: Y253H

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126816
SMART Domains Protein: ENSMUSP00000115018
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
Pfam:Gelsolin 23 78 4.4e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129173
AA Change: Y253H

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000123405
Gene: ENSMUSG00000025432
AA Change: Y253H

DomainStartEndE-ValueType
GEL 14 111 9.44e-24 SMART
GEL 132 226 8.89e-20 SMART
GEL 253 346 1.19e-29 SMART
GEL 395 492 2.07e-29 SMART
GEL 512 598 4.01e-27 SMART
GEL 617 711 2.81e-31 SMART
VHP 784 819 1.31e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142698
SMART Domains Protein: ENSMUSP00000117667
Gene: ENSMUSG00000025432

DomainStartEndE-ValueType
SCOP:d1d4xg_ 5 53 2e-17 SMART
PDB:2VIL|A 14 53 2e-14 PDB
Blast:GEL 14 54 7e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000152054
SMART Domains Protein: ENSMUSP00000122669
Gene: ENSMUSG00000040521

DomainStartEndE-ValueType
Pfam:UBA 44 81 1.2e-10 PFAM
SCOP:d1efub4 101 120 5e-4 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the gelsolin/villin family of actin regulatory proteins. This protein has structural similarity to villin. It binds actin and may play a role in the development of neuronal cells that form ganglia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes null mice show partial embryonic lethality before E10.5, but surviving mice are fertile and exhibit no abnormal behavior into adult. The regenerative axon growth and remodeling of sensory nerves are abnormal in homozygous null mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Avil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avil APN 10 127017034 critical splice donor site probably null
IGL01893:Avil APN 10 127020546 missense possibly damaging 0.73
IGL02127:Avil APN 10 127011826 missense probably benign 0.13
IGL02425:Avil APN 10 127018447 missense probably benign
IGL02458:Avil APN 10 127016353 missense probably benign 0.00
IGL02707:Avil APN 10 127006562 missense probably damaging 1.00
IGL02805:Avil APN 10 127007617 missense possibly damaging 0.79
IGL02836:Avil APN 10 127008995 missense probably damaging 1.00
IGL02961:Avil APN 10 127008306 missense probably benign 0.00
IGL03025:Avil APN 10 127013577 missense probably benign 0.19
IGL03083:Avil APN 10 127016324 missense probably benign 0.31
IGL03345:Avil APN 10 127008957 unclassified probably benign
IGL03365:Avil APN 10 127010983 missense probably damaging 1.00
R0109:Avil UTSW 10 127013644 missense probably benign
R0109:Avil UTSW 10 127013644 missense probably benign
R1159:Avil UTSW 10 127011790 missense possibly damaging 0.94
R1631:Avil UTSW 10 127010625 unclassified probably null
R2026:Avil UTSW 10 127011873 missense probably damaging 1.00
R3948:Avil UTSW 10 127014205 missense probably benign 0.00
R4165:Avil UTSW 10 127006627 nonsense probably null
R4978:Avil UTSW 10 127018396 missense probably benign 0.09
R5159:Avil UTSW 10 127020448 critical splice acceptor site probably null
R5254:Avil UTSW 10 127011761 missense probably benign 0.01
R5285:Avil UTSW 10 127018459 missense probably damaging 0.97
R5618:Avil UTSW 10 127010577 missense possibly damaging 0.79
R5682:Avil UTSW 10 127014104 missense probably damaging 1.00
R5786:Avil UTSW 10 127016499 critical splice donor site probably null
R5819:Avil UTSW 10 127009998 missense probably damaging 1.00
R6149:Avil UTSW 10 127006582 missense probably benign 0.25
R6631:Avil UTSW 10 127007749 missense possibly damaging 0.52
R6665:Avil UTSW 10 127020525 missense probably damaging 1.00
R6745:Avil UTSW 10 127014119 missense probably benign 0.00
R6804:Avil UTSW 10 127008306 nonsense probably null
R6838:Avil UTSW 10 127013562 missense probably benign
R7481:Avil UTSW 10 127007591 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TGGCAAAGGACATTCGGGAC -3'
(R):5'- CAGAAAGGTTCTACCCGCAG -3'

Sequencing Primer
(F):5'- CATTCGGGACAGGGAGCG -3'
(R):5'- AAGGGAGGATAGCTGCCTCTC -3'
Posted On2015-02-19