Incidental Mutation 'R3694:Bcas3'
ID268911
Institutional Source Beutler Lab
Gene Symbol Bcas3
Ensembl Gene ENSMUSG00000059439
Gene Namebreast carcinoma amplified sequence 3
Synonyms2610028P08Rik, 1500019F07Rik, rudhira, K20D4
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location85353167-85826058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85801802 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 338 (V338L)
Ref Sequence ENSEMBL: ENSMUSP00000090497 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074875] [ENSMUST00000092821] [ENSMUST00000092822] [ENSMUST00000108061] [ENSMUST00000108062]
Predicted Effect probably benign
Transcript: ENSMUST00000074875
AA Change: V830L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074416
Gene: ENSMUSG00000059439
AA Change: V830L

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 792 2.3e-33 PFAM
low complexity region 885 901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092821
AA Change: V815L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090496
Gene: ENSMUSG00000059439
AA Change: V815L

DomainStartEndE-ValueType
Blast:WD40 56 104 3e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 776 3.8e-35 PFAM
low complexity region 870 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092822
AA Change: V338L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000090497
Gene: ENSMUSG00000059439
AA Change: V338L

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
low complexity region 28 37 N/A INTRINSIC
Pfam:BCAS3 44 298 1.2e-35 PFAM
low complexity region 415 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108061
AA Change: V830L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103696
Gene: ENSMUSG00000059439
AA Change: V830L

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 789 1e-33 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108062
AA Change: V830L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103697
Gene: ENSMUSG00000059439
AA Change: V830L

DomainStartEndE-ValueType
Blast:WD40 56 104 2e-17 BLAST
WD40 340 380 7.7e-1 SMART
WD40 390 433 2.47e1 SMART
low complexity region 480 494 N/A INTRINSIC
low complexity region 505 514 N/A INTRINSIC
Pfam:BCAS3 521 796 1.3e-28 PFAM
low complexity region 899 913 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128213
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140673
Predicted Effect unknown
Transcript: ENSMUST00000142596
AA Change: V356L
SMART Domains Protein: ENSMUSP00000122571
Gene: ENSMUSG00000059439
AA Change: V356L

DomainStartEndE-ValueType
low complexity region 7 21 N/A INTRINSIC
low complexity region 32 41 N/A INTRINSIC
Pfam:BCAS3 48 323 3e-29 PFAM
low complexity region 434 450 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149662
SMART Domains Protein: ENSMUSP00000120891
Gene: ENSMUSG00000059439

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000154396
AA Change: V594L
SMART Domains Protein: ENSMUSP00000122154
Gene: ENSMUSG00000059439
AA Change: V594L

DomainStartEndE-ValueType
WD40 120 160 7.7e-1 SMART
WD40 170 213 2.47e1 SMART
low complexity region 260 274 N/A INTRINSIC
low complexity region 285 294 N/A INTRINSIC
Pfam:BCAS3 301 561 1e-30 PFAM
low complexity region 650 666 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Bcas3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Bcas3 APN 11 85365591 missense probably damaging 0.98
IGL00754:Bcas3 APN 11 85495823 splice site probably benign
IGL01712:Bcas3 APN 11 85581048 missense probably damaging 0.99
IGL02073:Bcas3 APN 11 85557437 missense probably damaging 1.00
IGL02261:Bcas3 APN 11 85531930 missense probably damaging 1.00
IGL02323:Bcas3 APN 11 85495845 missense probably damaging 0.97
IGL02493:Bcas3 APN 11 85495882 missense probably damaging 0.99
IGL02609:Bcas3 APN 11 85457894 missense probably damaging 1.00
IGL02808:Bcas3 APN 11 85495851 missense probably benign 0.02
IGL03085:Bcas3 APN 11 85476783 missense probably damaging 1.00
IGL03263:Bcas3 APN 11 85822122 intron probably benign
FR4340:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4342:Bcas3 UTSW 11 85509497 missense probably benign 0.12
FR4589:Bcas3 UTSW 11 85509497 missense probably benign 0.12
IGL02991:Bcas3 UTSW 11 85457887 nonsense probably null
PIT4377001:Bcas3 UTSW 11 85495842 missense probably damaging 0.98
PIT4472001:Bcas3 UTSW 11 85531900 missense probably damaging 0.99
R0145:Bcas3 UTSW 11 85359610 splice site probably benign
R0257:Bcas3 UTSW 11 85822039 missense probably benign 0.00
R0276:Bcas3 UTSW 11 85470837 critical splice donor site probably null
R0485:Bcas3 UTSW 11 85495850 missense probably damaging 0.99
R1053:Bcas3 UTSW 11 85557410 missense probably benign 0.10
R1833:Bcas3 UTSW 11 85583949 missense probably benign 0.00
R2107:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2108:Bcas3 UTSW 11 85457878 missense probably damaging 0.97
R2215:Bcas3 UTSW 11 85801943 missense probably damaging 0.99
R2404:Bcas3 UTSW 11 85354889 splice site probably benign
R2413:Bcas3 UTSW 11 85531855 missense probably damaging 1.00
R3880:Bcas3 UTSW 11 85371122 missense probably benign 0.02
R4241:Bcas3 UTSW 11 85470826 missense probably damaging 0.99
R4794:Bcas3 UTSW 11 85509468 missense probably damaging 1.00
R5035:Bcas3 UTSW 11 85543945 missense probably damaging 1.00
R5073:Bcas3 UTSW 11 85371132 missense probably damaging 1.00
R5245:Bcas3 UTSW 11 85559086 missense probably damaging 1.00
R5358:Bcas3 UTSW 11 85451755 missense probably benign 0.02
R5395:Bcas3 UTSW 11 85825249 missense probably damaging 0.99
R5615:Bcas3 UTSW 11 85470761 missense probably damaging 1.00
R5753:Bcas3 UTSW 11 85822084 intron probably benign
R6198:Bcas3 UTSW 11 85509435 missense probably damaging 0.99
R6668:Bcas3 UTSW 11 85801851 missense probably damaging 0.98
R7170:Bcas3 UTSW 11 85495918 missense probably damaging 0.96
R7171:Bcas3 UTSW 11 85583937 missense probably damaging 1.00
R7672:Bcas3 UTSW 11 85395387 nonsense probably null
R7689:Bcas3 UTSW 11 85495887 missense probably benign 0.10
R7912:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
R7993:Bcas3 UTSW 11 85371128 missense probably damaging 1.00
V3553:Bcas3 UTSW 11 85822100 intron probably benign
X0020:Bcas3 UTSW 11 85531808 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ACACGTGTACTCTCTGATGTAGC -3'
(R):5'- CAGGCTACAAGTCTGTTGACG -3'

Sequencing Primer
(F):5'- GTACTCTCTGATGTAGCAGTCAGC -3'
(R):5'- GACGCCTTTACCTGTTCCAG -3'
Posted On2015-02-19