Mutagenetix > Incidental Mutation

Incidental Mutation 'R3694:Ints2'

268912

Institutional Source

Beutler Lab

Gene Symbol

Ints2

Ensembl Gene

ENSMUSG00000018068

Gene Name

integrator complex subunit 2

Synonyms

2810417D08Rik

MMRRC Submission

040689-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86210681-86257575 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86243001 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 408 (M408V)

Ref Sequence

ENSEMBL: ENSMUSP00000103674 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018212] [ENSMUST00000108039]

AlphaFold

Q80UK8

Predicted Effect

probably benign
Transcript: ENSMUST00000018212
AA Change: M408V

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000018212
Gene: ENSMUSG00000018068
AA Change: M408V

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1131	N/A	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108039
AA Change: M408V

PolyPhen 2 Score 0.405 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000103674
Gene: ENSMUSG00000018068
AA Change: M408V

Domain	Start	End	E-Value	Type
Pfam:INTS2	24	1132	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127745

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134883

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143819

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS2 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,550,516	I97V	possibly damaging	Het
4833423E24Rik	T	G	2: 85,494,110	I291L	probably benign	Het
AI182371	A	G	2: 35,085,752	C267R	probably benign	Het
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp8b1	G	A	18: 64,533,721	T1135I	possibly damaging	Het
Avil	T	C	10: 127,008,330	Y253H	probably damaging	Het
Bcas3	G	T	11: 85,801,802	V338L	probably benign	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Ccdc158	T	C	5: 92,610,045	E1056G	probably damaging	Het
Clcn7	T	A	17: 25,159,707	I722N	probably damaging	Het
Cnga3	T	C	1: 37,261,740	Y552H	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp3a25	A	T	5: 145,989,976		probably null	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Eya1	A	G	1: 14,229,501	Y343H	probably damaging	Het
Fbln5	T	C	12: 101,765,252	N228D	probably benign	Het
Fmo5	T	C	3: 97,645,914	F393L	probably damaging	Het
Gpr63	A	G	4: 25,007,993	Y239C	probably damaging	Het
Lztr1	G	A	16: 17,509,061	A12T	possibly damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Mutyh	T	A	4: 116,816,454	S146T	possibly damaging	Het
Obscn	T	C	11: 59,078,395	K2460E	probably damaging	Het
Olfr1179	A	T	2: 88,402,196	I246N	possibly damaging	Het
Olfr1466	T	C	19: 13,342,529	I257T	possibly damaging	Het
Ppfia4	G	T	1: 134,312,567	T896K	probably damaging	Het
Ppp2r2a	C	A	14: 67,019,750	D344Y	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Scn9a	T	G	2: 66,562,405	E281A	probably benign	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syt7	G	T	19: 10,435,636	R265L	possibly damaging	Het
Tub	A	G	7: 109,027,832	S313G	probably benign	Het
Vmn2r18	A	G	5: 151,584,568	F364L	probably benign	Het
Vmn2r77	A	G	7: 86,800,836	N97D	probably damaging	Het
Vmn2r85	A	G	10: 130,418,302	S838P	probably damaging	Het
Vmn2r92	T	A	17: 18,151,943	L5*	probably null	Het
Zfyve28	A	G	5: 34,217,468	F401L	probably damaging	Het

Other mutations in Ints2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00807:Ints2	APN	11	86233135	missense	probably damaging	1.00
IGL02490:Ints2	APN	11	86233183	missense	possibly damaging	0.93
IGL02612:Ints2	APN	11	86215578	missense	probably damaging	1.00
IGL03396:Ints2	APN	11	86213062	missense	probably damaging	0.99
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0015:Ints2	UTSW	11	86249287	missense	probably damaging	1.00
R0355:Ints2	UTSW	11	86234749	missense	probably benign	0.00
R0389:Ints2	UTSW	11	86248851	missense	probably damaging	1.00
R0631:Ints2	UTSW	11	86233196	missense	probably benign	0.02
R0944:Ints2	UTSW	11	86244463	missense	possibly damaging	0.85
R1268:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1269:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1270:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1396:Ints2	UTSW	11	86249248	missense	probably damaging	0.98
R1474:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1503:Ints2	UTSW	11	86226781	missense	probably damaging	0.97
R1840:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R1987:Ints2	UTSW	11	86217800	missense	probably benign	0.03
R1990:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R1991:Ints2	UTSW	11	86248934	missense	possibly damaging	0.58
R4056:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4057:Ints2	UTSW	11	86242952	missense	probably damaging	1.00
R4569:Ints2	UTSW	11	86256198	missense	probably damaging	1.00
R4585:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4586:Ints2	UTSW	11	86249275	missense	probably damaging	1.00
R4806:Ints2	UTSW	11	86256209	missense	probably benign	0.10
R4929:Ints2	UTSW	11	86212653	missense	possibly damaging	0.56
R5031:Ints2	UTSW	11	86256200	missense	probably damaging	1.00
R5064:Ints2	UTSW	11	86249274	missense	probably damaging	1.00
R5270:Ints2	UTSW	11	86215795	missense	probably damaging	1.00
R5621:Ints2	UTSW	11	86242947	missense	probably benign	0.32
R5875:Ints2	UTSW	11	86238312	missense	probably benign	0.04
R5908:Ints2	UTSW	11	86215545	critical splice donor site	probably null
R5914:Ints2	UTSW	11	86222174	missense	probably benign	0.03
R5941:Ints2	UTSW	11	86250972	missense	probably benign	0.01
R5975:Ints2	UTSW	11	86226748	missense	possibly damaging	0.72
R6003:Ints2	UTSW	11	86238468	missense	probably damaging	1.00
R6091:Ints2	UTSW	11	86236603	missense	probably damaging	0.96
R6209:Ints2	UTSW	11	86225058	missense	probably damaging	1.00
R6567:Ints2	UTSW	11	86226661	missense	probably benign	0.42
R6764:Ints2	UTSW	11	86212779	missense	probably benign	0.00
R7033:Ints2	UTSW	11	86233085	missense	probably damaging	1.00
R7132:Ints2	UTSW	11	86217754	missense	probably benign	0.26
R7337:Ints2	UTSW	11	86217842	missense	probably benign	0.00
R7410:Ints2	UTSW	11	86233226	missense	probably benign	0.02
R7483:Ints2	UTSW	11	86215618	missense	probably damaging	1.00
R7503:Ints2	UTSW	11	86232055	missense	probably benign
R7804:Ints2	UTSW	11	86212663	missense	possibly damaging	0.92
R7845:Ints2	UTSW	11	86238263	missense	possibly damaging	0.93
R7875:Ints2	UTSW	11	86213062	missense	probably damaging	0.99
R7918:Ints2	UTSW	11	86222217	missense	probably damaging	1.00
R7922:Ints2	UTSW	11	86244627	missense	probably benign	0.29
R8058:Ints2	UTSW	11	86255353	missense	probably benign	0.05
R8134:Ints2	UTSW	11	86212660	missense	probably damaging	1.00
R8189:Ints2	UTSW	11	86215570	missense	probably damaging	1.00
R8295:Ints2	UTSW	11	86225088	missense	probably damaging	0.97
R8348:Ints2	UTSW	11	86255423	missense	probably benign
R8448:Ints2	UTSW	11	86255423	missense	probably benign
R8784:Ints2	UTSW	11	86222137	missense	probably damaging	1.00
R8784:Ints2	UTSW	11	86225115	nonsense	probably null
R8942:Ints2	UTSW	11	86212894	missense	probably benign	0.00
R9037:Ints2	UTSW	11	86215704	missense	probably benign
R9154:Ints2	UTSW	11	86234698	missense	probably damaging	1.00
R9397:Ints2	UTSW	11	86244485	missense	probably benign	0.01
R9412:Ints2	UTSW	11	86226763	missense	probably damaging	0.99
R9472:Ints2	UTSW	11	86242998	missense
R9476:Ints2	UTSW	11	86244509	missense	probably benign
R9510:Ints2	UTSW	11	86244509	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACGCTCGTCCGTACATGAAC -3'
(R):5'- ATGCCTTCGTGTGTGCTAC -3'

Sequencing Primer
(F):5'- GCTCGTCCGTACATGAACAATTAG -3'
(R):5'- GTGTGTGCTACTCACCTGCAG -3'

Posted On

2015-02-19