Mutagenetix > Incidental Mutations

Incidental Mutation 'R3694:Ppp2r2a'

268914

Institutional Source

Beutler Lab

Gene Symbol

Ppp2r2a

Ensembl Gene

ENSMUSG00000022052

Gene Name

protein phosphatase 2, regulatory subunit B, alpha

Synonyms

2410004D02Rik

MMRRC Submission

040689-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R3694 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

67014056-67072444 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 67019750 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 344 (D344Y)

Ref Sequence

ENSEMBL: ENSMUSP00000153191 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089230] [ENSMUST00000225251] [ENSMUST00000225380]

Predicted Effect

probably damaging
Transcript: ENSMUST00000089230
AA Change: D344Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000086640
Gene: ENSMUSG00000022052
AA Change: D344Y

Domain	Start	End	E-Value	Type
WD40	21	56	1.33e1	SMART
WD40	83	123	6.88e0	SMART
WD40	165	204	2.3e0	SMART
WD40	215	255	8.88e0	SMART
WD40	274	312	5.11e1	SMART
WD40	339	370	1.42e2	SMART
WD40	406	443	2.47e1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223630

Predicted Effect

probably benign
Transcript: ENSMUST00000225251

Predicted Effect

probably damaging
Transcript: ENSMUST00000225380
AA Change: D344Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225469

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 97.1%
20x: 94.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the phosphatase 2 regulatory subunit B family. Protein phosphatase 2 is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. The B regulatory subunit might modulate substrate selectivity and catalytic activity. This gene encodes an alpha isoform of the regulatory subunit B55 subfamily. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2010]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900092C05Rik	A	G	7: 12,550,516	I97V	possibly damaging	Het
4833423E24Rik	T	G	2: 85,494,110	I291L	probably benign	Het
AI182371	A	G	2: 35,085,752	C267R	probably benign	Het
Ankrd29	G	A	18: 12,254,700	A275V	possibly damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atp8b1	G	A	18: 64,533,721	T1135I	possibly damaging	Het
Avil	T	C	10: 127,008,330	Y253H	probably damaging	Het
Bcas3	G	T	11: 85,801,802	V338L	probably benign	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Ccdc158	T	C	5: 92,610,045	E1056G	probably damaging	Het
Clcn7	T	A	17: 25,159,707	I722N	probably damaging	Het
Cnga3	T	C	1: 37,261,740	Y552H	probably damaging	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Cyp3a25	A	T	5: 145,989,976		probably null	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Eya1	A	G	1: 14,229,501	Y343H	probably damaging	Het
Fbln5	T	C	12: 101,765,252	N228D	probably benign	Het
Fmo5	T	C	3: 97,645,914	F393L	probably damaging	Het
Gpr63	A	G	4: 25,007,993	Y239C	probably damaging	Het
Ints2	T	C	11: 86,243,001	M408V	probably benign	Het
Lztr1	G	A	16: 17,509,061	A12T	possibly damaging	Het
Magi2	A	AG	5: 20,602,461		probably null	Het
Mutyh	T	A	4: 116,816,454	S146T	possibly damaging	Het
Obscn	T	C	11: 59,078,395	K2460E	probably damaging	Het
Olfr1179	A	T	2: 88,402,196	I246N	possibly damaging	Het
Olfr1466	T	C	19: 13,342,529	I257T	possibly damaging	Het
Ppfia4	G	T	1: 134,312,567	T896K	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Scn9a	T	G	2: 66,562,405	E281A	probably benign	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syt7	G	T	19: 10,435,636	R265L	possibly damaging	Het
Tub	A	G	7: 109,027,832	S313G	probably benign	Het
Vmn2r18	A	G	5: 151,584,568	F364L	probably benign	Het
Vmn2r77	A	G	7: 86,800,836	N97D	probably damaging	Het
Vmn2r85	A	G	10: 130,418,302	S838P	probably damaging	Het
Vmn2r92	T	A	17: 18,151,943	L5*	probably null	Het
Zfyve28	A	G	5: 34,217,468	F401L	probably damaging	Het

Other mutations in Ppp2r2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01620:Ppp2r2a	APN	14	67070277	missense	probably damaging	0.96
IGL01997:Ppp2r2a	APN	14	67016519	missense	probably benign
IGL02024:Ppp2r2a	APN	14	67038912	missense	probably benign	0.06
IGL02178:Ppp2r2a	APN	14	67023097	missense	probably damaging	1.00
IGL03148:Ppp2r2a	APN	14	67022295	missense	probably benign	0.00
IGL03304:Ppp2r2a	APN	14	67016528	missense	probably benign	0.13
limber	UTSW	14	67019804	missense	probably damaging	1.00
R1216:Ppp2r2a	UTSW	14	67028998	nonsense	probably null
R1576:Ppp2r2a	UTSW	14	67038869	splice site	probably benign
R1629:Ppp2r2a	UTSW	14	67019759	missense	possibly damaging	0.93
R1662:Ppp2r2a	UTSW	14	67016603	missense	probably benign
R1808:Ppp2r2a	UTSW	14	67038963	missense	probably damaging	1.00
R1937:Ppp2r2a	UTSW	14	67016429	missense	possibly damaging	0.93
R2121:Ppp2r2a	UTSW	14	67023128	missense	probably damaging	1.00
R2134:Ppp2r2a	UTSW	14	67016475	missense	possibly damaging	0.63
R3150:Ppp2r2a	UTSW	14	67023765	missense	probably damaging	1.00
R3695:Ppp2r2a	UTSW	14	67019750	missense	probably damaging	1.00
R3825:Ppp2r2a	UTSW	14	67022443	missense	probably damaging	0.98
R4031:Ppp2r2a	UTSW	14	67028976	missense	probably damaging	1.00
R4209:Ppp2r2a	UTSW	14	67028879	missense	probably damaging	1.00
R4353:Ppp2r2a	UTSW	14	67028937	missense	probably damaging	1.00
R4639:Ppp2r2a	UTSW	14	67038957	missense	probably damaging	1.00
R4976:Ppp2r2a	UTSW	14	67016637	missense	possibly damaging	0.71
R5001:Ppp2r2a	UTSW	14	67022308	nonsense	probably null
R5106:Ppp2r2a	UTSW	14	67023097	missense	probably damaging	1.00
R5322:Ppp2r2a	UTSW	14	67038873	critical splice donor site	probably null
R5360:Ppp2r2a	UTSW	14	67016571	nonsense	probably null
R5429:Ppp2r2a	UTSW	14	67023756	missense	probably damaging	1.00
R5439:Ppp2r2a	UTSW	14	67022323	missense	possibly damaging	0.70
R6250:Ppp2r2a	UTSW	14	67038954	missense	probably damaging	1.00
R6582:Ppp2r2a	UTSW	14	67019804	missense	probably damaging	1.00
R8263:Ppp2r2a	UTSW	14	67023756	missense	probably damaging	1.00
R8315:Ppp2r2a	UTSW	14	67023728	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTTATTCACAGCTACCTGGAAG -3'
(R):5'- CTGCAATACCCAGAAAGGTGG -3'

Sequencing Primer
(F):5'- CCTGGAAGAAAAGTGACTCTTAACTG -3'
(R):5'- TGTGAGTAAGGGTTGTCAAAAGTAC -3'

Posted On

2015-02-19