Incidental Mutation 'R3694:Lztr1'
ID268916
Institutional Source Beutler Lab
Gene Symbol Lztr1
Ensembl Gene ENSMUSG00000022761
Gene Nameleucine-zipper-like transcriptional regulator, 1
Synonyms1200003E21Rik, TCFL2
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3694 (G1)
Quality Score224
Status Not validated
Chromosome16
Chromosomal Location17508688-17526333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17509061 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 12 (A12T)
Ref Sequence ENSEMBL: ENSMUSP00000156071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023444] [ENSMUST00000023448] [ENSMUST00000115681] [ENSMUST00000115685] [ENSMUST00000231292] [ENSMUST00000231994] [ENSMUST00000232242] [ENSMUST00000232372]
Predicted Effect probably benign
Transcript: ENSMUST00000023444
AA Change: A12T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023444
Gene: ENSMUSG00000022761
AA Change: A12T

DomainStartEndE-ValueType
Pfam:Kelch_6 64 103 1.1e-7 PFAM
Pfam:Kelch_1 64 105 1.7e-7 PFAM
Pfam:Kelch_4 64 113 4.7e-10 PFAM
Pfam:Kelch_3 74 123 3.1e-10 PFAM
Pfam:Kelch_5 111 152 7.2e-9 PFAM
Pfam:Kelch_1 114 161 2.8e-7 PFAM
Pfam:Kelch_2 114 163 1e-7 PFAM
Pfam:Kelch_4 114 170 1.9e-6 PFAM
Pfam:Kelch_3 124 180 9.1e-9 PFAM
Pfam:Kelch_4 171 224 6.1e-6 PFAM
Pfam:Kelch_3 181 232 6e-7 PFAM
Pfam:Kelch_1 224 267 1e-6 PFAM
Pfam:Kelch_4 225 278 6.2e-6 PFAM
Pfam:Kelch_3 234 289 2.2e-8 PFAM
Pfam:Kelch_1 280 325 7.7e-10 PFAM
Pfam:Kelch_2 280 325 4.3e-7 PFAM
Pfam:Kelch_6 280 325 9.6e-9 PFAM
Pfam:Kelch_4 280 329 2.5e-8 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 765 2.95e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023448
SMART Domains Protein: ENSMUSP00000023448
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 3.6e-18 PFAM
Pfam:Rieske_2 70 166 7.7e-11 PFAM
Pfam:Pyr_redox_2 196 473 1.1e-34 PFAM
Pfam:Pyr_redox 334 416 7e-17 PFAM
Pfam:Reductase_C 512 591 9.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115681
AA Change: A12T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111345
Gene: ENSMUSG00000022761
AA Change: A12T

DomainStartEndE-ValueType
Pfam:Kelch_5 63 99 1.1e-6 PFAM
Pfam:Kelch_1 64 105 1.6e-8 PFAM
Pfam:Kelch_4 64 113 5.8e-9 PFAM
Pfam:Kelch_6 64 115 2.6e-9 PFAM
Pfam:Kelch_3 74 123 2.4e-11 PFAM
Pfam:Kelch_5 111 150 5.5e-10 PFAM
Pfam:Kelch_1 114 161 5.8e-8 PFAM
Pfam:Kelch_2 114 163 3.1e-8 PFAM
Pfam:Kelch_4 114 170 1e-9 PFAM
Pfam:Kelch_3 124 180 2.5e-10 PFAM
Pfam:Kelch_5 168 204 6.1e-7 PFAM
Pfam:Kelch_4 171 224 7.9e-8 PFAM
Pfam:Kelch_3 181 233 9.1e-8 PFAM
Pfam:Kelch_4 223 279 3.1e-7 PFAM
Pfam:Kelch_1 224 267 1.9e-6 PFAM
Pfam:Kelch_3 234 289 1.5e-8 PFAM
Pfam:Kelch_1 280 325 2.9e-10 PFAM
Pfam:Kelch_2 280 325 1.3e-7 PFAM
Pfam:Kelch_6 280 326 2.4e-9 PFAM
Pfam:Kelch_4 280 335 1.7e-9 PFAM
Pfam:Kelch_5 381 419 2.8e-7 PFAM
BTB 440 571 4.16e-4 SMART
BTB 664 797 1.7e-18 SMART
low complexity region 808 821 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115685
SMART Domains Protein: ENSMUSP00000111349
Gene: ENSMUSG00000022763

DomainStartEndE-ValueType
Pfam:Rieske 68 161 6.5e-23 PFAM
Pfam:Rieske_2 70 166 1.4e-10 PFAM
Pfam:Pyr_redox_2 195 493 1.6e-65 PFAM
Pfam:Pyr_redox 334 416 7.3e-18 PFAM
Pfam:Reductase_C 512 586 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149234
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152077
Predicted Effect possibly damaging
Transcript: ENSMUST00000231292
AA Change: A12T

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231508
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231800
Predicted Effect probably benign
Transcript: ENSMUST00000231994
AA Change: A12T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232242
Predicted Effect probably benign
Transcript: ENSMUST00000232372
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232421
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232644
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the BR-C, ttk and bab-kelch superfamily that, in humans, localizes to the Golgi network and is associated with the ras / mitogen-activated protein kinase pathway. Loss-of-function mutations in the human ortholog are associated with glioblastoma multiforme, schwannomatosis, Noonan syndrome, and DiGeorge syndrome. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Lztr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Lztr1 APN 16 17517450 splice site probably benign
IGL01152:Lztr1 APN 16 17522453 missense probably damaging 1.00
IGL01501:Lztr1 APN 16 17522391 unclassified probably null
IGL01512:Lztr1 APN 16 17522391 unclassified probably null
IGL01514:Lztr1 APN 16 17522391 unclassified probably null
IGL01516:Lztr1 APN 16 17522391 unclassified probably null
IGL01933:Lztr1 APN 16 17520591 missense probably damaging 1.00
IGL02603:Lztr1 APN 16 17509686 missense possibly damaging 0.77
IGL03012:Lztr1 APN 16 17521484 missense possibly damaging 0.92
IGL03191:Lztr1 APN 16 17518528 missense probably damaging 1.00
R0331:Lztr1 UTSW 16 17524237 unclassified probably benign
R0717:Lztr1 UTSW 16 17516048 unclassified probably null
R1511:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R1925:Lztr1 UTSW 16 17523383 missense probably damaging 1.00
R2062:Lztr1 UTSW 16 17509670 missense probably damaging 1.00
R3935:Lztr1 UTSW 16 17522195 nonsense probably null
R4645:Lztr1 UTSW 16 17524091 unclassified probably benign
R5624:Lztr1 UTSW 16 17512129 splice site probably benign
R7175:Lztr1 UTSW 16 17523031 missense possibly damaging 0.84
R7222:Lztr1 UTSW 16 17524132 missense possibly damaging 0.86
R7420:Lztr1 UTSW 16 17524129 missense probably damaging 1.00
R7515:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R7516:Lztr1 UTSW 16 17509661 missense possibly damaging 0.87
R8027:Lztr1 UTSW 16 17512112
Predicted Primers PCR Primer
(F):5'- TCGATATACGATAATGCGAGGAGC -3'
(R):5'- GATCCCTGTACACTGTCGTAC -3'

Sequencing Primer
(F):5'- TGCCAGGTTCCTCGATAGC -3'
(R):5'- TGTACACTGTCGTACCGGGC -3'
Posted On2015-02-19