Incidental Mutation 'R3694:Crygs'
ID268917
Institutional Source Beutler Lab
Gene Symbol Crygs
Ensembl Gene ENSMUSG00000033501
Gene Namecrystallin, gamma S
SynonymsOpj
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location22805203-22811577 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 22805551 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 102 (G102D)
Ref Sequence ENSEMBL: ENSMUSP00000043588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040592]
PDB Structure
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin [SOLUTION NMR]
NMR structure of murine gamma-S crystallin from joint refinement with SAXS data [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040592
AA Change: G102D

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043588
Gene: ENSMUSG00000033501
AA Change: G102D

DomainStartEndE-ValueType
XTALbg 7 86 5.98e-40 SMART
XTALbg 95 176 6.26e-43 SMART
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. Since lens central fiber cells lose their nuclei during development, these crystallins are made and then retained throughout life, making them extremely stable proteins. Mammalian lens crystallins are divided into alpha, beta, and gamma families; beta and gamma crystallins are also considered as a superfamily. Alpha and beta families are further divided into acidic and basic groups. Seven protein regions exist in crystallins: four homologous motifs, a connecting peptide, and N- and C-terminal extensions. Gamma-crystallins are a homogeneous group of highly symmetrical, monomeric proteins typically lacking connecting peptides and terminal extensions. They are differentially regulated after early development. This gene encodes a protein initially considered to be a beta-crystallin but the encoded protein is monomeric and has greater sequence similarity to other gamma-crystallins. This gene encodes the most significant gamma-crystallin in adult eye lens tissue. Whether due to aging or mutations in specific genes, gamma-crystallins have been involved in cataract formation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene can cause cataracts and/or disrupted lens fiber cell morphology and organization. Aging mice homozygous for a knock-out allele do not develop cataracts but show focusing defects associated with inefficient clearance of cellular organelles and altered actin distribution. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Crygs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Crygs APN 16 22806562 missense possibly damaging 0.81
R1694:Crygs UTSW 16 22806675 splice site probably null
R1932:Crygs UTSW 16 22806554 missense probably benign 0.12
R2206:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2275:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2298:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2299:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2300:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2326:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2329:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2330:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2331:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2332:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2857:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2895:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2896:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2921:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R2922:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3120:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3196:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3427:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3609:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3611:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3625:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3693:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3695:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3870:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3871:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R3876:Crygs UTSW 16 22806512 missense probably damaging 1.00
R4052:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4207:Crygs UTSW 16 22805551 missense possibly damaging 0.93
R4299:Crygs UTSW 16 22805411 nonsense probably null
R4630:Crygs UTSW 16 22805518 missense possibly damaging 0.90
R7392:Crygs UTSW 16 22806502 missense probably benign 0.35
R7573:Crygs UTSW 16 22805319 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGAACTCTATGGTCCCACTCC -3'
(R):5'- AGAGTTCTGATGACCCTCCC -3'

Sequencing Primer
(F):5'- TCACTCCACAATGCGGCG -3'
(R):5'- TGATGACCCTCCCTTAAGGATGAG -3'
Posted On2015-02-19