Incidental Mutation 'R3694:Ankrd29'
ID268923
Institutional Source Beutler Lab
Gene Symbol Ankrd29
Ensembl Gene ENSMUSG00000057766
Gene Nameankyrin repeat domain 29
Synonyms
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location12252362-12305720 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 12254700 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 275 (A275V)
Ref Sequence ENSEMBL: ENSMUSP00000114028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118525] [ENSMUST00000122408]
Predicted Effect possibly damaging
Transcript: ENSMUST00000118525
AA Change: A275V

PolyPhen 2 Score 0.835 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114028
Gene: ENSMUSG00000057766
AA Change: A275V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
ANK 242 271 3.01e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122408
AA Change: A242V

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112888
Gene: ENSMUSG00000057766
AA Change: A242V

DomainStartEndE-ValueType
ANK 11 41 3.04e0 SMART
ANK 45 74 9.93e-5 SMART
ANK 78 107 1.09e-1 SMART
ANK 111 140 1.2e-3 SMART
ANK 144 173 3.76e-5 SMART
ANK 177 206 1.02e-1 SMART
ANK 210 239 1.52e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137948
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Ankrd29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Ankrd29 APN 18 12275738 missense probably benign 0.00
IGL02956:Ankrd29 APN 18 12260936 missense probably damaging 1.00
R0456:Ankrd29 UTSW 18 12295979 missense probably damaging 1.00
R2879:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3693:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3699:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R3700:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4130:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4132:Ankrd29 UTSW 18 12254700 missense possibly damaging 0.83
R4745:Ankrd29 UTSW 18 12254622 missense probably benign 0.00
R4989:Ankrd29 UTSW 18 12262185 missense probably damaging 1.00
R5531:Ankrd29 UTSW 18 12279778 missense probably damaging 1.00
R5985:Ankrd29 UTSW 18 12279775 missense probably damaging 1.00
R6187:Ankrd29 UTSW 18 12279690 nonsense probably null
R6627:Ankrd29 UTSW 18 12262164 missense probably benign 0.02
R6895:Ankrd29 UTSW 18 12260989 missense probably benign 0.36
R7671:Ankrd29 UTSW 18 12260986 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTATAGGGCAGTGTGAGAAGCC -3'
(R):5'- AGAACAGCGGGTACTACTTCTC -3'

Sequencing Primer
(F):5'- CCACAGGGCAGACATTCTTTC -3'
(R):5'- GAACAGCGGGTACTACTTCTCATTAG -3'
Posted On2015-02-19