Incidental Mutation 'R3694:Cabp2'
ID268926
Institutional Source Beutler Lab
Gene Symbol Cabp2
Ensembl Gene ENSMUSG00000024857
Gene Namecalcium binding protein 2
Synonyms
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4081578-4087340 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4083593 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000125255 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159148] [ENSMUST00000159556] [ENSMUST00000159593] [ENSMUST00000162908]
Predicted Effect probably benign
Transcript: ENSMUST00000159148
SMART Domains Protein: ENSMUSP00000125740
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
EFh 65 93 2.62e-5 SMART
Blast:EFh 101 126 3e-6 BLAST
EFh 139 167 1.26e-7 SMART
EFh 176 203 3.85e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159556
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000124389
Gene: ENSMUSG00000024857
AA Change: T12A

DomainStartEndE-ValueType
EFh 30 58 2.62e-5 SMART
Blast:EFh 66 91 2e-6 BLAST
EFh 104 132 1.26e-7 SMART
EFh 141 168 3.85e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159593
SMART Domains Protein: ENSMUSP00000124607
Gene: ENSMUSG00000024857

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
Pfam:EF-hand_1 65 93 2.8e-9 PFAM
Pfam:EF-hand_6 65 96 6.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162584
Predicted Effect probably benign
Transcript: ENSMUST00000162908
AA Change: T12A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000125255
Gene: ENSMUSG00000024857
AA Change: T12A

DomainStartEndE-ValueType
low complexity region 25 39 N/A INTRINSIC
EFh 83 111 2.62e-5 SMART
Blast:EFh 119 144 4e-6 BLAST
EFh 157 185 1.26e-7 SMART
EFh 194 221 3.85e-3 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a subfamily of calcium binding proteins that share similarity to calmodulin. Like calmodulin, these family members can likely stimulate calmodulin-dependent kinase II and the protein phosphatase calcineurin. Calcium binding proteins are an important component of calcium mediated cellular signal transduction. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous knockout affects calcium channels in cochlear inner hair cell synapses, resulting in hearing impairment. It also affects transmission of responses to light through the retinal circuits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Cabp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Cabp2 APN 19 4084868 splice site probably benign
IGL02338:Cabp2 APN 19 4084154 missense possibly damaging 0.74
R0017:Cabp2 UTSW 19 4086242 missense possibly damaging 0.88
R0153:Cabp2 UTSW 19 4084913 splice site probably benign
R0432:Cabp2 UTSW 19 4084903 missense possibly damaging 0.59
R2027:Cabp2 UTSW 19 4087126 missense probably damaging 1.00
R3693:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R3695:Cabp2 UTSW 19 4083593 missense probably benign 0.02
R5935:Cabp2 UTSW 19 4086497 missense probably damaging 1.00
R5939:Cabp2 UTSW 19 4086470 missense possibly damaging 0.85
R6413:Cabp2 UTSW 19 4085698 splice site probably null
R7023:Cabp2 UTSW 19 4082658 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- ACTCAGAGATAATCCCGGATTGG -3'
(R):5'- GCCTATCAGTTTAGCAGGGG -3'

Sequencing Primer
(F):5'- ATCCCGGATTGGATTAGGGCC -3'
(R):5'- CCTATCAGTTTAGCAGGGGAGCAC -3'
Posted On2015-02-19