Incidental Mutation 'R3694:Rbm4'
ID268927
Institutional Source Beutler Lab
Gene Symbol Rbm4
Ensembl Gene ENSMUSG00000094936
Gene NameRNA binding motif protein 4
SynonymsLark1, Rbm4a
MMRRC Submission 040689-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.465) question?
Stock #R3694 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4784293-4793901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4787383 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 358 (Y358H)
Ref Sequence ENSEMBL: ENSMUSP00000137345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164209] [ENSMUST00000164376] [ENSMUST00000172000] [ENSMUST00000178353] [ENSMUST00000178615] [ENSMUST00000179189] [ENSMUST00000179909] [ENSMUST00000180248]
Predicted Effect probably benign
Transcript: ENSMUST00000164209
SMART Domains Protein: ENSMUSP00000129745
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164376
SMART Domains Protein: ENSMUSP00000127564
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 172 4.62e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172000
AA Change: Y474H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128810
Gene: ENSMUSG00000096370
AA Change: Y474H

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 116 1.5e-5 PFAM
RRM 119 184 5.4e-20 SMART
RRM 195 260 4.77e-21 SMART
ZnF_C2HC 277 293 1.75e-5 SMART
low complexity region 343 362 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178404
Predicted Effect probably benign
Transcript: ENSMUST00000178615
SMART Domains Protein: ENSMUSP00000136254
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178727
Predicted Effect probably benign
Transcript: ENSMUST00000179189
SMART Domains Protein: ENSMUSP00000137174
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179820
Predicted Effect unknown
Transcript: ENSMUST00000179909
AA Change: Y333H
SMART Domains Protein: ENSMUSP00000136623
Gene: ENSMUSG00000096370
AA Change: Y333H

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 138 1.83e0 SMART
ZnF_C2HC 136 152 1.75e-5 SMART
low complexity region 202 221 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180248
AA Change: Y358H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137345
Gene: ENSMUSG00000094936
AA Change: Y358H

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
low complexity region 227 246 N/A INTRINSIC
low complexity region 283 296 N/A INTRINSIC
Meta Mutation Damage Score 0.4637 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display reduced postnatal body weight, decreased insulin levels, smaller pancreatic islets and impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Olfr1466 T C 19: 13,342,529 I257T possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Rbm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0311:Rbm4 UTSW 19 4787556 missense probably damaging 1.00
R2093:Rbm4 UTSW 19 4787764 missense probably damaging 0.99
R3693:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R3695:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R6103:Rbm4 UTSW 19 4787919 missense probably damaging 0.98
R7598:Rbm4 UTSW 19 4792511 missense possibly damaging 0.73
R7810:Rbm4 UTSW 19 4792622 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCAAAGGATGTTTACCTCAAACTTC -3'
(R):5'- AATAGACATCTGTTGCCGCC -3'

Sequencing Primer
(F):5'- CAGCATTTAAAGATGTGTCTGTAGAC -3'
(R):5'- CTACTTCATATTACGGGCGGGATC -3'
Posted On2015-02-19