Incidental Mutation 'R3694:Olfr1466'
ID 268929
Institutional Source Beutler Lab
Gene Symbol Olfr1466
Ensembl Gene ENSMUSG00000096485
Gene Name olfactory receptor 1466
Synonyms MOR202-12, GA_x6K02T2RE5P-3672907-3673839
MMRRC Submission 040689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R3694 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 13338862-13343572 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13342529 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 257 (I257T)
Ref Sequence ENSEMBL: ENSMUSP00000147188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075868] [ENSMUST00000207124]
AlphaFold Q8VFW4
Predicted Effect possibly damaging
Transcript: ENSMUST00000075868
AA Change: I257T

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000075265
Gene: ENSMUSG00000096485
AA Change: I257T

DomainStartEndE-ValueType
Pfam:7tm_4 32 310 4.1e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 306 1.9e-6 PFAM
Pfam:7tm_1 42 291 7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207124
AA Change: I257T

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik A G 7: 12,550,516 I97V possibly damaging Het
4833423E24Rik T G 2: 85,494,110 I291L probably benign Het
AI182371 A G 2: 35,085,752 C267R probably benign Het
Ankrd29 G A 18: 12,254,700 A275V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp8b1 G A 18: 64,533,721 T1135I possibly damaging Het
Avil T C 10: 127,008,330 Y253H probably damaging Het
Bcas3 G T 11: 85,801,802 V338L probably benign Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Ccdc158 T C 5: 92,610,045 E1056G probably damaging Het
Clcn7 T A 17: 25,159,707 I722N probably damaging Het
Cnga3 T C 1: 37,261,740 Y552H probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Cyp3a25 A T 5: 145,989,976 probably null Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Eya1 A G 1: 14,229,501 Y343H probably damaging Het
Fbln5 T C 12: 101,765,252 N228D probably benign Het
Fmo5 T C 3: 97,645,914 F393L probably damaging Het
Gpr63 A G 4: 25,007,993 Y239C probably damaging Het
Ints2 T C 11: 86,243,001 M408V probably benign Het
Lztr1 G A 16: 17,509,061 A12T possibly damaging Het
Magi2 A AG 5: 20,602,461 probably null Het
Mutyh T A 4: 116,816,454 S146T possibly damaging Het
Obscn T C 11: 59,078,395 K2460E probably damaging Het
Olfr1179 A T 2: 88,402,196 I246N possibly damaging Het
Ppfia4 G T 1: 134,312,567 T896K probably damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Scn9a T G 2: 66,562,405 E281A probably benign Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syt7 G T 19: 10,435,636 R265L possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r18 A G 5: 151,584,568 F364L probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Vmn2r85 A G 10: 130,418,302 S838P probably damaging Het
Vmn2r92 T A 17: 18,151,943 L5* probably null Het
Zfyve28 A G 5: 34,217,468 F401L probably damaging Het
Other mutations in Olfr1466
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02442:Olfr1466 APN 19 13342120 missense probably benign 0.13
IGL02568:Olfr1466 APN 19 13342219 missense probably benign 0.08
IGL03073:Olfr1466 APN 19 13342022 missense probably benign 0.00
R0943:Olfr1466 UTSW 19 13341793 missense probably benign 0.00
R1301:Olfr1466 UTSW 19 13341847 missense probably benign 0.05
R1355:Olfr1466 UTSW 19 13342518 nonsense probably null
R1524:Olfr1466 UTSW 19 13342122 nonsense probably null
R1568:Olfr1466 UTSW 19 13342175 missense probably benign 0.14
R1993:Olfr1466 UTSW 19 13341814 missense possibly damaging 0.65
R2031:Olfr1466 UTSW 19 13342406 missense probably benign 0.18
R3693:Olfr1466 UTSW 19 13342529 missense possibly damaging 0.73
R3853:Olfr1466 UTSW 19 13342498 missense possibly damaging 0.55
R5313:Olfr1466 UTSW 19 13342065 missense probably benign 0.07
R5467:Olfr1466 UTSW 19 13342157 missense probably damaging 1.00
R6060:Olfr1466 UTSW 19 13342133 missense probably benign 0.08
R7125:Olfr1466 UTSW 19 13341739 critical splice acceptor site probably null
R7591:Olfr1466 UTSW 19 13342255 missense probably benign 0.28
R9072:Olfr1466 UTSW 19 13341874 missense possibly damaging 0.80
R9073:Olfr1466 UTSW 19 13341874 missense possibly damaging 0.80
R9523:Olfr1466 UTSW 19 13342484 missense probably damaging 0.99
Z1177:Olfr1466 UTSW 19 13342255 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCAGCAATCATGGCTCTCTC -3'
(R):5'- GCACTCAGATCATGAACTTATAAGC -3'

Sequencing Primer
(F):5'- GCTCTGATAGACATGTTAATGAACTG -3'
(R):5'- CTCAGGCTGTAAACTAAAGG -3'
Posted On 2015-02-19