Incidental Mutation 'R3695:Gabrr2'
ID268938
Institutional Source Beutler Lab
Gene Symbol Gabrr2
Ensembl Gene ENSMUSG00000023267
Gene Namegamma-aminobutyric acid (GABA) C receptor, subunit rho 2
Synonyms
Accession Numbers

Genbank: NM_008076; MGI: 95626; Ensembl: ENSMUST00000108162, ENSMUST00000147889, ENSMUST00000131920, ENSMUST00000024035

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3695 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location33062999-33095865 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33071430 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 65 (D65G)
Ref Sequence ENSEMBL: ENSMUSP00000103797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024035] [ENSMUST00000108162]
Predicted Effect probably damaging
Transcript: ENSMUST00000024035
AA Change: D90G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000024035
Gene: ENSMUSG00000023267
AA Change: D90G

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 81 286 3.4e-53 PFAM
Pfam:Neur_chan_memb 293 454 1.9e-32 PFAM
transmembrane domain 472 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108162
AA Change: D65G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103797
Gene: ENSMUSG00000023267
AA Change: D65G

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Neur_chan_LBD 57 261 9.7e-57 PFAM
Pfam:Neur_chan_memb 268 414 4.2e-36 PFAM
transmembrane domain 447 464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Gamma-aminobutyric acid (GABA) is the major inhibitory neurotransmitter in the mammalian brain where it acts at GABA receptors, which are ligand-gated chloride channels. The protein encoded by this gene is a member of the rho subunit family and is a component of the GABA type A receptor complex. This gene exists on chromosome 6q next to the gene encoding the rho 1 subunit of the GABA type A receptor, in a region thought to be associated with susceptibility for psychiatric disorders and epilepsy. Polymorphisms in this gene may also be associated with alcohol dependence, and general cognitive ability. [provided by RefSeq, Apr 2016]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Hsp90ab1 T C 17: 45,571,477 D97G probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pkd2l2 A G 18: 34,438,790 N614S possibly damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tsnaxip1 A G 8: 105,833,535 T40A possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Wscd2 T A 5: 113,551,017 I28N possibly damaging Het
Other mutations in Gabrr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gabrr2 APN 4 33085626 missense probably damaging 1.00
IGL02070:Gabrr2 APN 4 33095340 nonsense probably null
IGL03283:Gabrr2 APN 4 33082364 splice site probably benign
D3080:Gabrr2 UTSW 4 33084466 missense probably damaging 1.00
R1250:Gabrr2 UTSW 4 33063273 missense probably benign 0.20
R1381:Gabrr2 UTSW 4 33081420 missense probably damaging 1.00
R1630:Gabrr2 UTSW 4 33085647 missense probably damaging 1.00
R1782:Gabrr2 UTSW 4 33085593 missense probably damaging 1.00
R1830:Gabrr2 UTSW 4 33077481 missense probably damaging 1.00
R2000:Gabrr2 UTSW 4 33084400 missense probably damaging 1.00
R2125:Gabrr2 UTSW 4 33095548 missense probably damaging 1.00
R2679:Gabrr2 UTSW 4 33071435 missense probably damaging 1.00
R3891:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R3892:Gabrr2 UTSW 4 33081348 missense probably damaging 1.00
R4902:Gabrr2 UTSW 4 33095512 missense probably damaging 1.00
R5328:Gabrr2 UTSW 4 33082565 missense probably damaging 1.00
R5330:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5331:Gabrr2 UTSW 4 33082583 missense possibly damaging 0.87
R5399:Gabrr2 UTSW 4 33071458 critical splice donor site probably null
R7299:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7301:Gabrr2 UTSW 4 33095284 missense probably benign 0.02
R7605:Gabrr2 UTSW 4 33082560 missense probably damaging 1.00
R7697:Gabrr2 UTSW 4 33071358 missense probably benign
R7860:Gabrr2 UTSW 4 33081470 nonsense probably null
R7943:Gabrr2 UTSW 4 33081470 nonsense probably null
X0017:Gabrr2 UTSW 4 33082328 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTGTAGAGACCCTTTAGTC -3'
(R):5'- TGTCAACAGCCTCTCCACTG -3'

Sequencing Primer
(F):5'- GCCTCCTTGTGTGCATCAGAATAAAG -3'
(R):5'- ACTGCCTGCCTGTGACCAC -3'
Posted On2015-02-19