Incidental Mutation 'R3695:Dmrta1'
ID268940
Institutional Source Beutler Lab
Gene Symbol Dmrta1
Ensembl Gene ENSMUSG00000043753
Gene Namedoublesex and mab-3 related transcription factor like family A1
SynonymsDmrt4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3695 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location89679436-89694772 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 89692178 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 458 (Y458*)
Ref Sequence ENSEMBL: ENSMUSP00000057488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052478]
Predicted Effect probably null
Transcript: ENSMUST00000052478
AA Change: Y458*
SMART Domains Protein: ENSMUSP00000057488
Gene: ENSMUSG00000043753
AA Change: Y458*

DomainStartEndE-ValueType
low complexity region 20 37 N/A INTRINSIC
DM 82 135 2.31e-30 SMART
low complexity region 151 165 N/A INTRINSIC
Pfam:DMA 314 350 3.3e-21 PFAM
low complexity region 393 404 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131576
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile; however, females exhibit polyovular ovarian follicles while 25% of males display abnormal copulatory behavior toward other males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gabrr2 A G 4: 33,071,430 D65G probably damaging Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Hsp90ab1 T C 17: 45,571,477 D97G probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pkd2l2 A G 18: 34,438,790 N614S possibly damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tsnaxip1 A G 8: 105,833,535 T40A possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Wscd2 T A 5: 113,551,017 I28N possibly damaging Het
Other mutations in Dmrta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02154:Dmrta1 APN 4 89691913 missense probably benign 0.04
IGL02572:Dmrta1 APN 4 89691558 missense probably benign 0.01
IGL02875:Dmrta1 APN 4 89691748 missense possibly damaging 0.70
IGL02883:Dmrta1 APN 4 89688774 missense probably benign
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0097:Dmrta1 UTSW 4 89688872 missense probably benign 0.08
R0394:Dmrta1 UTSW 4 89692039 missense probably damaging 1.00
R2093:Dmrta1 UTSW 4 89691505 missense probably benign
R2132:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2133:Dmrta1 UTSW 4 89688709 missense probably damaging 1.00
R2401:Dmrta1 UTSW 4 89691616 missense probably benign 0.00
R3694:Dmrta1 UTSW 4 89692178 nonsense probably null
R3891:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3892:Dmrta1 UTSW 4 89691594 missense possibly damaging 0.93
R3929:Dmrta1 UTSW 4 89691444 nonsense probably null
R4620:Dmrta1 UTSW 4 89688784 missense probably benign 0.05
R4927:Dmrta1 UTSW 4 89691748 missense probably damaging 1.00
R4982:Dmrta1 UTSW 4 89688564 missense probably damaging 1.00
R5312:Dmrta1 UTSW 4 89692047 missense probably damaging 0.99
R5437:Dmrta1 UTSW 4 89691756 missense possibly damaging 0.71
R5637:Dmrta1 UTSW 4 89688831 missense probably benign
R6185:Dmrta1 UTSW 4 89691768 missense probably damaging 0.97
R6906:Dmrta1 UTSW 4 89691966 missense probably benign 0.06
R7156:Dmrta1 UTSW 4 89688463 missense probably damaging 0.99
R7201:Dmrta1 UTSW 4 89692171 nonsense probably null
R7755:Dmrta1 UTSW 4 89691933 missense probably benign 0.01
R7862:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7880:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
R7945:Dmrta1 UTSW 4 89688324 missense probably benign 0.00
R7963:Dmrta1 UTSW 4 89688844 missense possibly damaging 0.95
Z1177:Dmrta1 UTSW 4 89688408 missense probably damaging 0.97
Z1177:Dmrta1 UTSW 4 89688454 missense probably benign 0.37
Z1177:Dmrta1 UTSW 4 89688498 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GAGAGCGTCAGATTTTAGTCTTGC -3'
(R):5'- CTGAGAGGCCAAGCTTATGC -3'

Sequencing Primer
(F):5'- TCTTGAAGCTGCGTCTGC -3'
(R):5'- AGTACATTAAAAAGTGTGTGTGTGTG -3'
Posted On2015-02-19