Incidental Mutation 'R3695:Wscd2'
ID268942
Institutional Source Beutler Lab
Gene Symbol Wscd2
Ensembl Gene ENSMUSG00000063430
Gene NameWSC domain containing 2
Synonyms4933413A10Rik, C530024P05Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3695 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location113490333-113589725 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113551017 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 28 (I28N)
Ref Sequence ENSEMBL: ENSMUSP00000092021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094452]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094452
AA Change: I28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092021
Gene: ENSMUSG00000063430
AA Change: I28N

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
low complexity region 44 61 N/A INTRINSIC
WSC 133 225 6.11e-44 SMART
WSC 236 330 9.49e-41 SMART
Blast:WSC 389 409 2e-6 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181650
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Gabrr2 A G 4: 33,071,430 D65G probably damaging Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Hsp90ab1 T C 17: 45,571,477 D97G probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pkd2l2 A G 18: 34,438,790 N614S possibly damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tsnaxip1 A G 8: 105,833,535 T40A possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Other mutations in Wscd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Wscd2 APN 5 113551175 missense possibly damaging 0.56
IGL01113:Wscd2 APN 5 113570739 missense probably damaging 1.00
IGL01476:Wscd2 APN 5 113572321 missense probably damaging 0.99
IGL01894:Wscd2 APN 5 113572296 missense probably damaging 0.96
IGL02560:Wscd2 APN 5 113560984 missense probably benign 0.01
IGL02755:Wscd2 APN 5 113574031 missense possibly damaging 0.66
R0381:Wscd2 UTSW 5 113551131 missense probably damaging 0.96
R1144:Wscd2 UTSW 5 113561090 splice site probably null
R1858:Wscd2 UTSW 5 113551170 missense possibly damaging 0.63
R4231:Wscd2 UTSW 5 113560984 missense probably benign 0.00
R4232:Wscd2 UTSW 5 113560984 missense probably benign 0.00
R4667:Wscd2 UTSW 5 113577272 missense probably damaging 1.00
R4696:Wscd2 UTSW 5 113551179 missense probably benign
R5727:Wscd2 UTSW 5 113577350 missense possibly damaging 0.89
R6401:Wscd2 UTSW 5 113588145 makesense probably null
R7413:Wscd2 UTSW 5 113577341 missense probably benign 0.02
R7642:Wscd2 UTSW 5 113577414 missense possibly damaging 0.67
R7837:Wscd2 UTSW 5 113572333 missense probably damaging 1.00
R7920:Wscd2 UTSW 5 113572333 missense probably damaging 1.00
R8046:Wscd2 UTSW 5 113551115 missense not run
Predicted Primers PCR Primer
(F):5'- CCTTGCGGTTTCATTCTTGAGAAG -3'
(R):5'- GGTGTCCTTGCCCTTGAATG -3'

Sequencing Primer
(F):5'- CGGTTTCATTCTTGAGAAGTCCCAAG -3'
(R):5'- TACCTGCGTGCAATACTGGAG -3'
Posted On2015-02-19