Incidental Mutation 'R3695:Tsnaxip1'
ID268946
Institutional Source Beutler Lab
Gene Symbol Tsnaxip1
Ensembl Gene ENSMUSG00000031893
Gene Nametranslin-associated factor X (Tsnax) interacting protein 1
Synonyms1700016K08Rik, TXI1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R3695 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105827731-105844680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105833535 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 40 (T40A)
Ref Sequence ENSEMBL: ENSMUSP00000148715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000212566]
Predicted Effect probably benign
Transcript: ENSMUST00000034365
AA Change: T40A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893
AA Change: T40A

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 98 209 3.5e-33 PFAM
coiled coil region 304 342 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211949
Predicted Effect possibly damaging
Transcript: ENSMUST00000212566
AA Change: T40A

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Gabrr2 A G 4: 33,071,430 D65G probably damaging Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Hsp90ab1 T C 17: 45,571,477 D97G probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pkd2l2 A G 18: 34,438,790 N614S possibly damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Wscd2 T A 5: 113,551,017 I28N possibly damaging Het
Other mutations in Tsnaxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:Tsnaxip1 APN 8 105841423 missense probably benign 0.04
IGL00490:Tsnaxip1 APN 8 105842184 missense probably damaging 1.00
IGL00849:Tsnaxip1 APN 8 105842168 missense probably damaging 0.99
IGL01756:Tsnaxip1 APN 8 105842788 splice site probably benign
IGL01821:Tsnaxip1 APN 8 105837516 missense probably damaging 0.96
IGL02278:Tsnaxip1 APN 8 105827781 utr 5 prime probably benign
IGL02290:Tsnaxip1 APN 8 105833487 missense probably benign 0.00
IGL02980:Tsnaxip1 UTSW 8 105842210 missense probably damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R0239:Tsnaxip1 UTSW 8 105844488 missense possibly damaging 0.96
R1544:Tsnaxip1 UTSW 8 105827751 start gained probably benign
R1939:Tsnaxip1 UTSW 8 105840038 missense probably benign 0.04
R3024:Tsnaxip1 UTSW 8 105841743 missense probably damaging 1.00
R3853:Tsnaxip1 UTSW 8 105840701 splice site probably benign
R4044:Tsnaxip1 UTSW 8 105833545 splice site probably null
R4376:Tsnaxip1 UTSW 8 105841801 nonsense probably null
R4627:Tsnaxip1 UTSW 8 105841407 missense probably damaging 1.00
R4790:Tsnaxip1 UTSW 8 105833523 missense probably benign 0.12
R5806:Tsnaxip1 UTSW 8 105837496 missense possibly damaging 0.83
R5814:Tsnaxip1 UTSW 8 105843971 missense probably benign 0.00
R6045:Tsnaxip1 UTSW 8 105844187 missense probably benign 0.24
R6374:Tsnaxip1 UTSW 8 105841540 missense possibly damaging 0.55
R6406:Tsnaxip1 UTSW 8 105843983 missense probably benign 0.14
R7915:Tsnaxip1 UTSW 8 105842781 missense possibly damaging 0.88
R7918:Tsnaxip1 UTSW 8 105844535 missense probably benign 0.00
R8317:Tsnaxip1 UTSW 8 105827806 missense probably benign 0.07
R8377:Tsnaxip1 UTSW 8 105842547 missense probably damaging 1.00
R8534:Tsnaxip1 UTSW 8 105838738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATGCCCTATGGATTCGG -3'
(R):5'- TGAGTCTTTTCTGCCTAGAACAGC -3'

Sequencing Primer
(F):5'- CCCTATGGATTCGGGAAGGGTC -3'
(R):5'- TGGGCCCACTTTCAGATCAGTG -3'
Posted On2015-02-19