Mutagenetix > Incidental Mutations

Incidental Mutation 'R3695:Tsnaxip1'

268946

Institutional Source

Beutler Lab

Gene Symbol

Tsnaxip1

Ensembl Gene

ENSMUSG00000031893

Gene Name

translin-associated factor X (Tsnax) interacting protein 1

Synonyms

1700016K08Rik, TXI1

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.527) question?

Stock #

R3695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

105827731-105844680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 105833535 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 40 (T40A)

Ref Sequence

ENSEMBL: ENSMUSP00000148715 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034365] [ENSMUST00000212566]

Predicted Effect

probably benign
Transcript: ENSMUST00000034365
AA Change: T40A

PolyPhen 2 Score 0.235 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000034365
Gene: ENSMUSG00000031893
AA Change: T40A

Domain	Start	End	E-Value	Type
Pfam:TSNAXIP1_N	98	209	3.5e-33	PFAM
coiled coil region	304	342	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211949

Predicted Effect

possibly damaging
Transcript: ENSMUST00000212566
AA Change: T40A

PolyPhen 2 Score 0.606 (Sensitivity: 0.87; Specificity: 0.91)

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010106E10Rik	A	T	X: 112,556,315	L187F	probably damaging	Het
Abca17	G	C	17: 24,289,507	T1018R	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atxn7l1	A	G	12: 33,358,697	N286S	probably damaging	Het
B430306N03Rik	C	T	17: 48,319,166	T129I	possibly damaging	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Gabrr2	A	G	4: 33,071,430	D65G	probably damaging	Het
Grin3a	G	T	4: 49,792,704	T343K	possibly damaging	Het
Hsp90ab1	T	C	17: 45,571,477	D97G	probably damaging	Het
Mageb4	G	T	X: 86,252,394	R10S	probably damaging	Het
Mdm4	A	G	1: 132,991,993	L379S	probably benign	Het
Olfr1062	T	C	2: 86,423,643	E11G	probably damaging	Het
Olfr1090	A	T	2: 86,753,871	I289N	probably damaging	Het
Pde4b	C	T	4: 102,601,545	A466V	probably damaging	Het
Pkd2l2	A	G	18: 34,438,790	N614S	possibly damaging	Het
Ppp2r2a	C	A	14: 67,019,750	D344Y	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Skiv2l	A	G	17: 34,847,912	F154S	probably damaging	Het
St3gal2	A	G	8: 110,962,341	D171G	probably damaging	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syk	A	G	13: 52,622,765		probably null	Het
Tgs1	A	G	4: 3,604,949		probably null	Het
Tlr5	A	T	1: 182,975,347	R739W	probably damaging	Het
Tns2	G	T	15: 102,112,749	V942L	probably null	Het
Tub	A	G	7: 109,027,832	S313G	probably benign	Het
Vmn2r77	A	G	7: 86,800,836	N97D	probably damaging	Het
Wscd2	T	A	5: 113,551,017	I28N	possibly damaging	Het

Other mutations in Tsnaxip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Tsnaxip1	APN	8	105841423	missense	probably benign	0.04
IGL00490:Tsnaxip1	APN	8	105842184	missense	probably damaging	1.00
IGL00849:Tsnaxip1	APN	8	105842168	missense	probably damaging	0.99
IGL01756:Tsnaxip1	APN	8	105842788	splice site	probably benign
IGL01821:Tsnaxip1	APN	8	105837516	missense	probably damaging	0.96
IGL02278:Tsnaxip1	APN	8	105827781	utr 5 prime	probably benign
IGL02290:Tsnaxip1	APN	8	105833487	missense	probably benign	0.00
IGL02980:Tsnaxip1	UTSW	8	105842210	missense	probably damaging	0.96
R0239:Tsnaxip1	UTSW	8	105844488	missense	possibly damaging	0.96
R0239:Tsnaxip1	UTSW	8	105844488	missense	possibly damaging	0.96
R1544:Tsnaxip1	UTSW	8	105827751	start gained	probably benign
R1939:Tsnaxip1	UTSW	8	105840038	missense	probably benign	0.04
R3024:Tsnaxip1	UTSW	8	105841743	missense	probably damaging	1.00
R3853:Tsnaxip1	UTSW	8	105840701	splice site	probably benign
R4044:Tsnaxip1	UTSW	8	105833545	splice site	probably null
R4376:Tsnaxip1	UTSW	8	105841801	nonsense	probably null
R4627:Tsnaxip1	UTSW	8	105841407	missense	probably damaging	1.00
R4790:Tsnaxip1	UTSW	8	105833523	missense	probably benign	0.12
R5806:Tsnaxip1	UTSW	8	105837496	missense	possibly damaging	0.83
R5814:Tsnaxip1	UTSW	8	105843971	missense	probably benign	0.00
R6045:Tsnaxip1	UTSW	8	105844187	missense	probably benign	0.24
R6374:Tsnaxip1	UTSW	8	105841540	missense	possibly damaging	0.55
R6406:Tsnaxip1	UTSW	8	105843983	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- GTCATGCCCTATGGATTCGG -3'
(R):5'- TGAGTCTTTTCTGCCTAGAACAGC -3'

Sequencing Primer
(F):5'- CCCTATGGATTCGGGAAGGGTC -3'
(R):5'- TGGGCCCACTTTCAGATCAGTG -3'

Posted On

2015-02-19