Mutagenetix > Incidental Mutations

Incidental Mutation 'R3695:Abca17'

268955

Institutional Source

Beutler Lab

Gene Symbol

Abca17

Ensembl Gene

ENSMUSG00000035435

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 17

Synonyms

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3695 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24264259-24351029 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 24289507 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Arginine at position 1018 (T1018R)

Ref Sequence

ENSEMBL: ENSMUSP00000112538 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]

Predicted Effect

probably damaging
Transcript: ENSMUST00000039324
AA Change: T1018R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: T1018R

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
transmembrane domain	22	44	N/A	INTRINSIC
Pfam:ABC2_membrane_3	252	464	9.5e-17	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	6.7e-35	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000121226
AA Change: T1018R

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: T1018R

Domain	Start	End	E-Value	Type
low complexity region	4	18	N/A	INTRINSIC
Pfam:ABC2_membrane_3	21	464	1.2e-15	PFAM
AAA	547	729	5.71e-12	SMART
low complexity region	846	857	N/A	INTRINSIC
Pfam:ABC2_membrane_3	905	1307	1.1e-32	PFAM
low complexity region	1337	1351	N/A	INTRINSIC
AAA	1393	1577	1.15e-1	SMART
low complexity region	1697	1730	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010106E10Rik	A	T	X: 112,556,315	L187F	probably damaging	Het
Arsi	G	A	18: 60,916,651	G202E	probably benign	Het
Atxn7l1	A	G	12: 33,358,697	N286S	probably damaging	Het
B430306N03Rik	C	T	17: 48,319,166	T129I	possibly damaging	Het
Cabp2	A	G	19: 4,083,593	T12A	probably benign	Het
Crygs	C	T	16: 22,805,551	G102D	possibly damaging	Het
Dmrta1	T	A	4: 89,692,178	Y458*	probably null	Het
Gabrr2	A	G	4: 33,071,430	D65G	probably damaging	Het
Grin3a	G	T	4: 49,792,704	T343K	possibly damaging	Het
Hsp90ab1	T	C	17: 45,571,477	D97G	probably damaging	Het
Mageb4	G	T	X: 86,252,394	R10S	probably damaging	Het
Mdm4	A	G	1: 132,991,993	L379S	probably benign	Het
Olfr1062	T	C	2: 86,423,643	E11G	probably damaging	Het
Olfr1090	A	T	2: 86,753,871	I289N	probably damaging	Het
Pde4b	C	T	4: 102,601,545	A466V	probably damaging	Het
Pkd2l2	A	G	18: 34,438,790	N614S	possibly damaging	Het
Ppp2r2a	C	A	14: 67,019,750	D344Y	probably damaging	Het
Rbm4	A	G	19: 4,787,383	Y358H	probably damaging	Het
Skiv2l	A	G	17: 34,847,912	F154S	probably damaging	Het
St3gal2	A	G	8: 110,962,341	D171G	probably damaging	Het
Strn	T	C	17: 78,656,992	N515D	probably damaging	Het
Stxbp5l	A	T	16: 37,241,346	Y367*	probably null	Het
Syk	A	G	13: 52,622,765		probably null	Het
Tgs1	A	G	4: 3,604,949		probably null	Het
Tlr5	A	T	1: 182,975,347	R739W	probably damaging	Het
Tns2	G	T	15: 102,112,749	V942L	probably null	Het
Tsnaxip1	A	G	8: 105,833,535	T40A	possibly damaging	Het
Tub	A	G	7: 109,027,832	S313G	probably benign	Het
Vmn2r77	A	G	7: 86,800,836	N97D	probably damaging	Het
Wscd2	T	A	5: 113,551,017	I28N	possibly damaging	Het

Other mutations in Abca17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca17	APN	17	24295191	missense	probably benign	0.14
IGL00585:Abca17	APN	17	24300320	missense	probably damaging	0.99
IGL00941:Abca17	APN	17	24317130	missense	probably damaging	1.00
IGL01987:Abca17	APN	17	24346228	missense	probably benign	0.00
IGL01988:Abca17	APN	17	24334255	missense	probably damaging	0.99
IGL02223:Abca17	APN	17	24287935	nonsense	probably null
IGL02368:Abca17	APN	17	24287793	missense	probably benign	0.01
IGL02405:Abca17	APN	17	24279062	missense	possibly damaging	0.80
IGL02431:Abca17	APN	17	24298984	missense	probably benign	0.05
IGL02607:Abca17	APN	17	24327705	nonsense	probably null
IGL02706:Abca17	APN	17	24298992	missense	probably benign	0.00
IGL02729:Abca17	APN	17	24280481	missense	probably benign	0.06
IGL02818:Abca17	APN	17	24300352	missense	probably benign	0.02
IGL02891:Abca17	APN	17	24281366	missense	probably damaging	0.99
IGL03236:Abca17	APN	17	24326476	splice site	probably benign
IGL03299:Abca17	APN	17	24265591	missense	probably damaging	1.00
R0018:Abca17	UTSW	17	24313188	splice site	probably null
R0467:Abca17	UTSW	17	24313177	splice site	probably benign
R0671:Abca17	UTSW	17	24281249	missense	probably benign	0.00
R1175:Abca17	UTSW	17	24289351	missense	possibly damaging	0.91
R1397:Abca17	UTSW	17	24285759	missense	probably benign	0.18
R1398:Abca17	UTSW	17	24328537	missense	probably damaging	0.96
R1678:Abca17	UTSW	17	24335620	missense	probably benign	0.05
R1696:Abca17	UTSW	17	24267658	missense	possibly damaging	0.90
R1781:Abca17	UTSW	17	24267557	missense	possibly damaging	0.95
R1845:Abca17	UTSW	17	24267716	missense	probably damaging	1.00
R1970:Abca17	UTSW	17	24307575	missense	probably benign	0.00
R1997:Abca17	UTSW	17	24285726	missense	probably benign	0.02
R2141:Abca17	UTSW	17	24334266	missense	probably benign	0.00
R2199:Abca17	UTSW	17	24335624	missense	probably benign	0.19
R2394:Abca17	UTSW	17	24281216	splice site	probably null
R2442:Abca17	UTSW	17	24328632	missense	probably benign	0.02
R2509:Abca17	UTSW	17	24289613	splice site	probably benign
R2848:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2849:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2859:Abca17	UTSW	17	24281314	missense	possibly damaging	0.46
R2879:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R2935:Abca17	UTSW	17	24289507	missense	probably damaging	0.96
R3153:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3154:Abca17	UTSW	17	24328746	missense	probably damaging	1.00
R3434:Abca17	UTSW	17	24289537	missense	probably damaging	1.00
R3905:Abca17	UTSW	17	24296283	missense	probably benign	0.13
R4282:Abca17	UTSW	17	24299060	missense	possibly damaging	0.49
R4334:Abca17	UTSW	17	24318268	missense	probably damaging	1.00
R4350:Abca17	UTSW	17	24279046	critical splice donor site	probably null
R4548:Abca17	UTSW	17	24334271	missense	possibly damaging	0.82
R4626:Abca17	UTSW	17	24321084	missense	probably damaging	1.00
R4722:Abca17	UTSW	17	24265429	missense	probably damaging	1.00
R4745:Abca17	UTSW	17	24307453	missense	probably damaging	1.00
R4818:Abca17	UTSW	17	24317161	missense	probably damaging	0.98
R5279:Abca17	UTSW	17	24289414	missense	probably damaging	1.00
R5310:Abca17	UTSW	17	24281230	missense	probably benign	0.00
R5320:Abca17	UTSW	17	24307567	missense	probably damaging	1.00
R5435:Abca17	UTSW	17	24267614	missense	possibly damaging	0.90
R5622:Abca17	UTSW	17	24327668	missense	probably benign	0.14
R5776:Abca17	UTSW	17	24295158	missense	probably benign	0.09
R5928:Abca17	UTSW	17	24318185	missense	probably benign	0.01
R6013:Abca17	UTSW	17	24287846	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6035:Abca17	UTSW	17	24281245	missense	possibly damaging	0.79
R6052:Abca17	UTSW	17	24318191	missense	probably benign	0.00
R6063:Abca17	UTSW	17	24264344	missense	unknown
R6404:Abca17	UTSW	17	24265918	missense	probably benign	0.13
R6746:Abca17	UTSW	17	24346221	nonsense	probably null
R6819:Abca17	UTSW	17	24287793	missense	probably benign	0.01
R6828:Abca17	UTSW	17	24326415	missense	possibly damaging	0.91
R7043:Abca17	UTSW	17	24265500	missense	probably damaging	1.00
R7065:Abca17	UTSW	17	24327751	missense	probably damaging	1.00
R7123:Abca17	UTSW	17	24265975	missense	probably damaging	1.00
R7157:Abca17	UTSW	17	24335590	missense	possibly damaging	0.46
R7188:Abca17	UTSW	17	24335626	missense	possibly damaging	0.89
R7294:Abca17	UTSW	17	24321009	missense	not run
R7352:Abca17	UTSW	17	24289054	nonsense	probably null
R7355:Abca17	UTSW	17	24267647	missense	probably benign	0.00
R7358:Abca17	UTSW	17	24291555	missense	probably benign	0.00
R7411:Abca17	UTSW	17	24328569	missense	possibly damaging	0.52
R8039:Abca17	UTSW	17	24328725	missense	probably damaging	1.00
RF019:Abca17	UTSW	17	24287732	frame shift	probably null
RF024:Abca17	UTSW	17	24287732	frame shift	probably null
RF029:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
RF032:Abca17	UTSW	17	24287727	frame shift	probably null
RF036:Abca17	UTSW	17	24287727	critical splice donor site	probably benign
X0017:Abca17	UTSW	17	24317163	missense	probably benign	0.26
X0065:Abca17	UTSW	17	24334284	missense	probably damaging	1.00
Z1088:Abca17	UTSW	17	24279079	missense	probably damaging	0.96
Z1088:Abca17	UTSW	17	24279107	missense	probably benign	0.03
Z1088:Abca17	UTSW	17	24346219	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGAAAGGCAGTCTCACGCAC -3'
(R):5'- CGGCTGGAATTCAATAGAGAGC -3'

Sequencing Primer
(F):5'- CAGTCTCACGCACTGGTAC -3'
(R):5'- AGCCCATGATGAGTGTACTG -3'

Posted On

2015-02-19