Incidental Mutation 'R3695:Rbm4'
ID268963
Institutional Source Beutler Lab
Gene Symbol Rbm4
Ensembl Gene ENSMUSG00000094936
Gene NameRNA binding motif protein 4
SynonymsLark1, Rbm4a
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.475) question?
Stock #R3695 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location4784293-4793901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4787383 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 358 (Y358H)
Ref Sequence ENSEMBL: ENSMUSP00000137345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164209] [ENSMUST00000164376] [ENSMUST00000172000] [ENSMUST00000178353] [ENSMUST00000178615] [ENSMUST00000179189] [ENSMUST00000179909] [ENSMUST00000180248]
Predicted Effect probably benign
Transcript: ENSMUST00000164209
SMART Domains Protein: ENSMUSP00000129745
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164376
SMART Domains Protein: ENSMUSP00000127564
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 172 4.62e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000172000
AA Change: Y474H

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128810
Gene: ENSMUSG00000096370
AA Change: Y474H

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 116 1.5e-5 PFAM
RRM 119 184 5.4e-20 SMART
RRM 195 260 4.77e-21 SMART
ZnF_C2HC 277 293 1.75e-5 SMART
low complexity region 343 362 N/A INTRINSIC
low complexity region 399 412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178353
SMART Domains Protein: ENSMUSP00000136599
Gene: ENSMUSG00000096370

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
Pfam:RRM_1 81 118 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178404
Predicted Effect probably benign
Transcript: ENSMUST00000178615
SMART Domains Protein: ENSMUSP00000136254
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 143 1.23e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178727
Predicted Effect probably benign
Transcript: ENSMUST00000179189
SMART Domains Protein: ENSMUSP00000137174
Gene: ENSMUSG00000094936

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179820
Predicted Effect unknown
Transcript: ENSMUST00000179909
AA Change: Y333H
SMART Domains Protein: ENSMUSP00000136623
Gene: ENSMUSG00000096370
AA Change: Y333H

DomainStartEndE-ValueType
RRM 2 69 1.96e-17 SMART
RRM 80 138 1.83e0 SMART
ZnF_C2HC 136 152 1.75e-5 SMART
low complexity region 202 221 N/A INTRINSIC
low complexity region 258 271 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000180248
AA Change: Y358H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137345
Gene: ENSMUSG00000094936
AA Change: Y358H

DomainStartEndE-ValueType
RRM 3 68 5.4e-20 SMART
RRM 79 144 4.77e-21 SMART
ZnF_C2HC 161 177 1.75e-5 SMART
low complexity region 227 246 N/A INTRINSIC
low complexity region 283 296 N/A INTRINSIC
Meta Mutation Damage Score 0.4637 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display reduced postnatal body weight, decreased insulin levels, smaller pancreatic islets and impaired glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Gabrr2 A G 4: 33,071,430 D65G probably damaging Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Hsp90ab1 T C 17: 45,571,477 D97G probably damaging Het
Mageb4 G T X: 86,252,394 R10S probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pkd2l2 A G 18: 34,438,790 N614S possibly damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tsnaxip1 A G 8: 105,833,535 T40A possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Wscd2 T A 5: 113,551,017 I28N possibly damaging Het
Other mutations in Rbm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0311:Rbm4 UTSW 19 4787556 missense probably damaging 1.00
R2093:Rbm4 UTSW 19 4787764 missense probably damaging 0.99
R3693:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R3694:Rbm4 UTSW 19 4787383 missense probably damaging 1.00
R6103:Rbm4 UTSW 19 4787919 missense probably damaging 0.98
R7598:Rbm4 UTSW 19 4792511 missense possibly damaging 0.73
R7810:Rbm4 UTSW 19 4792622 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGATGTTTACCTCAAACTTCAGC -3'
(R):5'- TACAATAGACATCTGTTGCCGCC -3'

Sequencing Primer
(F):5'- GCATTTAAAGATGTGTCTGTAGACTG -3'
(R):5'- CTACTTCATATTACGGGCGGGATC -3'
Posted On2015-02-19