Incidental Mutation 'R3695:Mageb4'
ID268964
Institutional Source Beutler Lab
Gene Symbol Mageb4
Ensembl Gene ENSMUSG00000035427
Gene Namemelanoma antigen, family B, 4
SynonymsmMage-b4, Mage-b4, CN716893
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.017) question?
Stock #R3695 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location86250254-86305093 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 86252394 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 10 (R10S)
Ref Sequence ENSEMBL: ENSMUSP00000109602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096378] [ENSMUST00000113969]
Predicted Effect probably damaging
Transcript: ENSMUST00000096378
AA Change: R10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000094107
Gene: ENSMUSG00000035427
AA Change: R10S

DomainStartEndE-ValueType
Pfam:MAGE_N 3 97 7e-24 PFAM
Pfam:MAGE 118 288 3e-52 PFAM
internal_repeat_1 311 408 1.8e-29 PROSPERO
internal_repeat_1 458 555 1.8e-29 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000113969
AA Change: R10S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109602
Gene: ENSMUSG00000035427
AA Change: R10S

DomainStartEndE-ValueType
MAGE_N 3 95 1.15e-16 SMART
MAGE 118 288 1.17e-104 SMART
internal_repeat_1 311 408 1.8e-29 PROSPERO
internal_repeat_1 458 555 1.8e-29 PROSPERO
Meta Mutation Damage Score 0.4369 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MAGEB gene family. The members of this family have their entire coding sequences located in the last exon, and the encoded proteins show 50 to 68% sequence identity to each other. The promoters and first exons of the MAGEB genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. This gene is localized in the DSS (dosage-sensitive sex reversal) critical region. It is expressed in testis and placenta, and in a significant fraction of tumors of various histological types. The MAGEB genes are clustered on chromosome Xp22-p21. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010106E10Rik A T X: 112,556,315 L187F probably damaging Het
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atxn7l1 A G 12: 33,358,697 N286S probably damaging Het
B430306N03Rik C T 17: 48,319,166 T129I possibly damaging Het
Cabp2 A G 19: 4,083,593 T12A probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dmrta1 T A 4: 89,692,178 Y458* probably null Het
Gabrr2 A G 4: 33,071,430 D65G probably damaging Het
Grin3a G T 4: 49,792,704 T343K possibly damaging Het
Hsp90ab1 T C 17: 45,571,477 D97G probably damaging Het
Mdm4 A G 1: 132,991,993 L379S probably benign Het
Olfr1062 T C 2: 86,423,643 E11G probably damaging Het
Olfr1090 A T 2: 86,753,871 I289N probably damaging Het
Pde4b C T 4: 102,601,545 A466V probably damaging Het
Pkd2l2 A G 18: 34,438,790 N614S possibly damaging Het
Ppp2r2a C A 14: 67,019,750 D344Y probably damaging Het
Rbm4 A G 19: 4,787,383 Y358H probably damaging Het
Skiv2l A G 17: 34,847,912 F154S probably damaging Het
St3gal2 A G 8: 110,962,341 D171G probably damaging Het
Strn T C 17: 78,656,992 N515D probably damaging Het
Stxbp5l A T 16: 37,241,346 Y367* probably null Het
Syk A G 13: 52,622,765 probably null Het
Tgs1 A G 4: 3,604,949 probably null Het
Tlr5 A T 1: 182,975,347 R739W probably damaging Het
Tns2 G T 15: 102,112,749 V942L probably null Het
Tsnaxip1 A G 8: 105,833,535 T40A possibly damaging Het
Tub A G 7: 109,027,832 S313G probably benign Het
Vmn2r77 A G 7: 86,800,836 N97D probably damaging Het
Wscd2 T A 5: 113,551,017 I28N possibly damaging Het
Other mutations in Mageb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3693:Mageb4 UTSW X 86252394 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCTTTCCTAGCAGTGGTG -3'
(R):5'- AGGCCATGTGGATTCCTAGAATAG -3'

Sequencing Primer
(F):5'- GGTGGTGGGTGCCTCAC -3'
(R):5'- GTGATACTATGTTTGTACAGGAACC -3'
Posted On2015-02-19