Incidental Mutation 'R3552:Pbx1'
ID268967
Institutional Source Beutler Lab
Gene Symbol Pbx1
Ensembl Gene ENSMUSG00000052534
Gene Namepre B cell leukemia homeobox 1
SynonymsPbx1b, Pbx1a, D230003C07Rik, Pbx-1, 2310056B04Rik
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location168119364-168432270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 168158793 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 411 (P411L)
Ref Sequence ENSEMBL: ENSMUSP00000135516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064438] [ENSMUST00000176540] [ENSMUST00000176790] [ENSMUST00000188912]
Predicted Effect probably benign
Transcript: ENSMUST00000064438
AA Change: P320L

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066385
Gene: ENSMUSG00000052534
AA Change: P320L

DomainStartEndE-ValueType
Pfam:PBC 35 232 2e-106 PFAM
HOX 233 290 5.15e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097471
Predicted Effect possibly damaging
Transcript: ENSMUST00000176540
AA Change: P411L

PolyPhen 2 Score 0.884 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135516
Gene: ENSMUSG00000052534
AA Change: P411L

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:PBC 40 232 6.9e-98 PFAM
HOX 233 298 6.17e-18 SMART
low complexity region 323 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176790
SMART Domains Protein: ENSMUSP00000134925
Gene: ENSMUSG00000052534

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188912
SMART Domains Protein: ENSMUSP00000140606
Gene: ENSMUSG00000052534

DomainStartEndE-ValueType
Pfam:PBC 35 232 2.1e-106 PFAM
HOX 233 298 6.17e-18 SMART
Meta Mutation Damage Score 0.1501 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a homeobox protein that belongs to the three-amino-acid loop extension/Pre-B cell leukemia transcription factor (TALE/PBX) family of proteins. The encoded protein is involved in several biological processes during embryogenesis including steroidogenesis, sexual development and the maintenance of hematopoietic stem cells. This protein functions in the development of several organ systems and plays a role in skeletal patterning and programming. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous disruption of this gene causes late gestational death, hypoplasia/aplasia of many organs, impaired hematopoiesis, anemia, skin edema, axial and appendicular skeleton defects, absent adrenal glands, abnormal chondrocyte differentiation, and abnormal bone, kidney and pancreas development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Pbx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01530:Pbx1 APN 1 168191304 missense probably benign 0.00
IGL02256:Pbx1 APN 1 168183602 missense possibly damaging 0.88
IGL03040:Pbx1 APN 1 168427946 splice site probably benign
root_cause UTSW 1 168209534 missense probably damaging 1.00
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0240:Pbx1 UTSW 1 168203482 missense possibly damaging 0.88
R0947:Pbx1 UTSW 1 168203366 missense probably damaging 1.00
R1785:Pbx1 UTSW 1 168431378 missense probably benign 0.09
R1893:Pbx1 UTSW 1 168203410 missense possibly damaging 0.91
R4176:Pbx1 UTSW 1 168191272 splice site probably null
R4757:Pbx1 UTSW 1 168195881 missense probably damaging 1.00
R5024:Pbx1 UTSW 1 168183589 missense possibly damaging 0.93
R6102:Pbx1 UTSW 1 168183565 missense probably benign 0.05
R6296:Pbx1 UTSW 1 168183615 missense possibly damaging 0.71
R6302:Pbx1 UTSW 1 168191341 missense probably benign
R6488:Pbx1 UTSW 1 168191395 missense probably damaging 1.00
R6501:Pbx1 UTSW 1 168209534 missense probably damaging 1.00
R7014:Pbx1 UTSW 1 168431380 missense probably damaging 0.98
R7070:Pbx1 UTSW 1 168195768 missense probably damaging 0.98
R7677:Pbx1 UTSW 1 168203426 missense probably damaging 0.99
R7898:Pbx1 UTSW 1 168185047 missense probably benign 0.12
R7981:Pbx1 UTSW 1 168185047 missense probably benign 0.12
X0024:Pbx1 UTSW 1 168431365 nonsense probably null
X0027:Pbx1 UTSW 1 168183612 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- CTGATTGCTTCGACCTCCAG -3'
(R):5'- TCCAAAGGCTCTCTGGAAAATG -3'

Sequencing Primer
(F):5'- TCGACCTCCAGTCTGACCG -3'
(R):5'- GGCTCTCTGGAAAATGAACTCATCTG -3'
Posted On2015-02-19