Incidental Mutation 'R3552:Esrrg'
ID268968
Institutional Source Beutler Lab
Gene Symbol Esrrg
Ensembl Gene ENSMUSG00000026610
Gene Nameestrogen-related receptor gamma
SynonymsERR3, estrogen-related receptor 3, NR3B3, Errg
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location187608791-188214885 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 188150190 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 215 (V215I)
Ref Sequence ENSEMBL: ENSMUSP00000106564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939]
Predicted Effect probably benign
Transcript: ENSMUST00000027906
AA Change: V238I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: V238I

DomainStartEndE-ValueType
low complexity region 57 70 N/A INTRINSIC
ZnF_C4 125 196 4.04e-40 SMART
Blast:HOLI 203 233 5e-6 BLAST
HOLI 270 428 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110938
AA Change: V215I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: V215I

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110939
AA Change: V215I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: V215I

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
ZnF_C4 102 173 4.04e-40 SMART
Blast:HOLI 180 210 4e-6 BLAST
HOLI 247 405 1.64e-40 SMART
Meta Mutation Damage Score 0.0892 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Esrrg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Esrrg APN 1 188210910 missense probably damaging 1.00
IGL01635:Esrrg APN 1 188198600 missense probably damaging 1.00
IGL01642:Esrrg APN 1 188210915 missense probably benign 0.01
IGL02740:Esrrg APN 1 188198741 missense probably benign 0.04
IGL03126:Esrrg APN 1 187997987 intron probably benign
IGL03391:Esrrg APN 1 188150223 missense possibly damaging 0.70
R0395:Esrrg UTSW 1 188198635 missense probably damaging 1.00
R0645:Esrrg UTSW 1 188043341 missense probably benign 0.00
R1593:Esrrg UTSW 1 188066385 missense possibly damaging 0.94
R1700:Esrrg UTSW 1 188043653 missense probably damaging 1.00
R1855:Esrrg UTSW 1 188211098 missense probably damaging 1.00
R3605:Esrrg UTSW 1 188211102 missense possibly damaging 0.74
R4384:Esrrg UTSW 1 188043711 missense probably damaging 1.00
R5255:Esrrg UTSW 1 188146358 missense probably damaging 1.00
R5443:Esrrg UTSW 1 188043425 missense possibly damaging 0.78
R5511:Esrrg UTSW 1 188211107 missense probably damaging 1.00
R5516:Esrrg UTSW 1 188198730 missense possibly damaging 0.56
R5543:Esrrg UTSW 1 188150254 missense probably damaging 0.96
R5686:Esrrg UTSW 1 188150198 missense probably benign 0.24
R5990:Esrrg UTSW 1 188198798 missense probably damaging 1.00
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R6030:Esrrg UTSW 1 188198707 missense probably benign 0.04
R7058:Esrrg UTSW 1 188150306 missense probably damaging 1.00
R7487:Esrrg UTSW 1 188146423 missense probably benign 0.03
R8512:Esrrg UTSW 1 188043580 nonsense probably null
Z1088:Esrrg UTSW 1 188150218 missense probably benign 0.04
Z1177:Esrrg UTSW 1 188043555 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTCCAAAAGCCAGGCAGAG -3'
(R):5'- GGTTTCCAGAGAACTTACCTGG -3'

Sequencing Primer
(F):5'- GCTGTGAATTTCCCTAAACACTG -3'
(R):5'- GAACTTACCTGGAATATGTTTTGCCC -3'
Posted On2015-02-19