Mutagenetix > Incidental Mutation

Incidental Mutation 'R3552:Esrrg'

268968

Institutional Source

Beutler Lab

Gene Symbol

Esrrg

Ensembl Gene

ENSMUSG00000026610

Gene Name

estrogen-related receptor gamma

Synonyms

ERR3, estrogen-related receptor 3, NR3B3, Errg

MMRRC Submission

040669-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3552 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

187608791-188214885 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 188150190 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 215 (V215I)

Ref Sequence

ENSEMBL: ENSMUSP00000106564 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027906] [ENSMUST00000110938] [ENSMUST00000110939]

AlphaFold

P62509

Predicted Effect

probably benign
Transcript: ENSMUST00000027906
AA Change: V238I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000027906
Gene: ENSMUSG00000026610
AA Change: V238I

Domain	Start	End	E-Value	Type
low complexity region	57	70	N/A	INTRINSIC
ZnF_C4	125	196	4.04e-40	SMART
Blast:HOLI	203	233	5e-6	BLAST
HOLI	270	428	1.64e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110938
AA Change: V215I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000106563
Gene: ENSMUSG00000026610
AA Change: V215I

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
ZnF_C4	102	173	4.04e-40	SMART
Blast:HOLI	180	210	4e-6	BLAST
HOLI	247	405	1.64e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000110939
AA Change: V215I

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000106564
Gene: ENSMUSG00000026610
AA Change: V215I

Domain	Start	End	E-Value	Type
low complexity region	34	47	N/A	INTRINSIC
ZnF_C4	102	173	4.04e-40	SMART
Blast:HOLI	180	210	4e-6	BLAST
HOLI	247	405	1.64e-40	SMART

Meta Mutation Damage Score

0.0892

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the estrogen receptor-related receptor (ESRR) family, which belongs to the nuclear hormone receptor superfamily. All members of the ESRR family share an almost identical DNA binding domain, which is composed of two C4-type zinc finger motifs. The ESRR members are orphan nuclear receptors; they bind to the estrogen response element and steroidogenic factor 1 response element, and activate genes controlled by both response elements in the absence of any ligands. The ESRR family is closely related to the estrogen receptor (ER) family. They share target genes, co-regulators and promoters, and by targeting the same set of genes, the ESRRs seem to interfere with the ER-mediated estrogen response in various ways. It has been reported that the family member encoded by this gene functions as a transcriptional activator of DNA cytosine-5-methyltransferases 1 (Dnmt1) expression by direct binding to its response elements in the DNMT1 promoters, modulates cell proliferation and estrogen signaling in breast cancer, and negatively regulates bone morphogenetic protein 2-induced osteoblast differentiation and bone formation. Multiple alternatively spliced transcript variants have been identified, which mainly differ at the 5' end and some of which encode protein isoforms differing in the N-terminal region. [provided by RefSeq, Aug 2011]
PHENOTYPE: Nullizygous mutations lead to postnatal lethality. Homozygotes for a null allele show reduced birth weight, fasting hyperlactatemia, altered electrocardiograms and mitochondrial function, and agenesis of the renal papilla. Surviving homozygotes for a different null allele exhibit hearing loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,258,365		probably benign	Het
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Agk	A	G	6: 40,394,681	T371A	probably benign	Het
Akna	T	C	4: 63,398,124	M1V	probably null	Het
Aldh7a1	T	C	18: 56,550,292		probably null	Het
Ankrd26	A	T	6: 118,507,776	L1500H	probably damaging	Het
Atp13a5	T	A	16: 29,310,766	D452V	probably damaging	Het
Bahcc1	C	T	11: 120,276,772	T1333M	possibly damaging	Het
Carmil3	G	T	14: 55,507,402	R1276L	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Chrm2	A	T	6: 36,523,810	I201F	probably damaging	Het
Col16a1	A	G	4: 130,077,041	T618A	probably benign	Het
Dock2	T	C	11: 34,720,960	Y192C	probably benign	Het
Ep400	T	A	5: 110,729,287	E821V	unknown	Het
Evx1	A	T	6: 52,316,923	S359C	probably damaging	Het
Fcrls	A	G	3: 87,259,410	I92T	possibly damaging	Het
Gal3st1	T	A	11: 3,998,110	F106I	possibly damaging	Het
Gm9944	T	C	4: 144,453,043		probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Kcnh1	A	G	1: 192,238,766	N118D	probably damaging	Het
Khdrbs1	A	G	4: 129,720,791	I323T	possibly damaging	Het
Klhdc7b	T	C	15: 89,387,521	Y869H	probably benign	Het
Lrrc4c	T	A	2: 97,629,961	W311R	probably damaging	Het
Megf11	A	G	9: 64,695,463	D862G	possibly damaging	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Muc5b	A	G	7: 141,867,705	S4311G	probably benign	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Neo1	T	A	9: 58,893,878	K1140M	probably damaging	Het
Oc90	T	C	15: 65,878,801	Q365R	possibly damaging	Het
Olfr1012	T	C	2: 85,759,893	N161S	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Olfr48	A	C	2: 89,844,343	M210R	possibly damaging	Het
Oplah	C	T	15: 76,302,094	D734N	possibly damaging	Het
Pbx1	G	A	1: 168,158,793	P411L	possibly damaging	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Phox2b	C	A	5: 67,097,656	R150L	probably damaging	Het
Plscr2	A	G	9: 92,290,795	E169G	probably damaging	Het
Ptprn2	A	T	12: 116,888,877	Q518L	probably benign	Het
Rbl1	A	T	2: 157,195,585	I214K	probably benign	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Ryr3	T	A	2: 112,751,787	I2854F	probably damaging	Het
Shtn1	T	C	19: 58,975,038	Y615C	probably benign	Het
Sirt5	A	T	13: 43,383,167	N226Y	probably damaging	Het
Slc30a3	G	A	5: 31,095,078		probably benign	Het
Slc5a4b	A	G	10: 76,081,524	V226A	probably damaging	Het
Slf2	C	A	19: 44,934,951	S68*	probably null	Het
Smyd5	G	A	6: 85,442,211	E292K	probably damaging	Het
Spns1	A	G	7: 126,370,371	V512A	possibly damaging	Het
Sry	T	A	Y: 2,663,141	Q173L	unknown	Het
Ssrp1	C	A	2: 85,044,392	Q519K	probably benign	Het
Tgfbr3	T	C	5: 107,139,839	E498G	probably damaging	Het
Tnrc6b	T	G	15: 80,880,247	L650W	probably damaging	Het
Tnxb	A	T	17: 34,718,721	E3861D	probably damaging	Het
Trbc1	G	T	6: 41,539,645		probably benign	Het
Trpm7	T	A	2: 126,826,710		probably benign	Het
Usp39	G	A	6: 72,337,832	T197I	possibly damaging	Het
Vmn1r38	T	C	6: 66,776,493	H213R	possibly damaging	Het
Washc2	A	G	6: 116,220,568	D168G	probably damaging	Het
Washc4	A	G	10: 83,546,856	I45V	probably benign	Het
Zfp352	A	G	4: 90,225,102	E493G	probably benign	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het
Zfp735	C	A	11: 73,711,241	S337*	probably null	Het

Other mutations in Esrrg

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Esrrg	APN	1	188210910	missense	probably damaging	1.00
IGL01635:Esrrg	APN	1	188198600	missense	probably damaging	1.00
IGL01642:Esrrg	APN	1	188210915	missense	probably benign	0.01
IGL02740:Esrrg	APN	1	188198741	missense	probably benign	0.04
IGL03126:Esrrg	APN	1	187997987	intron	probably benign
IGL03391:Esrrg	APN	1	188150223	missense	possibly damaging	0.70
R0395:Esrrg	UTSW	1	188198635	missense	probably damaging	1.00
R0645:Esrrg	UTSW	1	188043341	missense	probably benign	0.00
R1593:Esrrg	UTSW	1	188066385	missense	possibly damaging	0.94
R1700:Esrrg	UTSW	1	188043653	missense	probably damaging	1.00
R1855:Esrrg	UTSW	1	188211098	missense	probably damaging	1.00
R3605:Esrrg	UTSW	1	188211102	missense	possibly damaging	0.74
R4384:Esrrg	UTSW	1	188043711	missense	probably damaging	1.00
R5255:Esrrg	UTSW	1	188146358	missense	probably damaging	1.00
R5443:Esrrg	UTSW	1	188043425	missense	possibly damaging	0.78
R5511:Esrrg	UTSW	1	188211107	missense	probably damaging	1.00
R5516:Esrrg	UTSW	1	188198730	missense	possibly damaging	0.56
R5543:Esrrg	UTSW	1	188150254	missense	probably damaging	0.96
R5686:Esrrg	UTSW	1	188150198	missense	probably benign	0.24
R5990:Esrrg	UTSW	1	188198798	missense	probably damaging	1.00
R6030:Esrrg	UTSW	1	188198707	missense	probably benign	0.04
R6030:Esrrg	UTSW	1	188198707	missense	probably benign	0.04
R7058:Esrrg	UTSW	1	188150306	missense	probably damaging	1.00
R7487:Esrrg	UTSW	1	188146423	missense	probably benign	0.03
R8512:Esrrg	UTSW	1	188043580	nonsense	probably null
R8735:Esrrg	UTSW	1	188201008	intron	probably benign
R8973:Esrrg	UTSW	1	188198750	missense	possibly damaging	0.79
R8986:Esrrg	UTSW	1	188210907	missense	possibly damaging	0.60
R9114:Esrrg	UTSW	1	188146408	missense	probably benign	0.01
R9114:Esrrg	UTSW	1	188146409	missense	possibly damaging	0.75
R9483:Esrrg	UTSW	1	188198651	missense	probably damaging	0.97
R9760:Esrrg	UTSW	1	188043372	missense	probably benign
Z1088:Esrrg	UTSW	1	188150218	missense	probably benign	0.04
Z1177:Esrrg	UTSW	1	188043555	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTTCCAAAAGCCAGGCAGAG -3'
(R):5'- GGTTTCCAGAGAACTTACCTGG -3'

Sequencing Primer
(F):5'- GCTGTGAATTTCCCTAAACACTG -3'
(R):5'- GAACTTACCTGGAATATGTTTTGCCC -3'

Posted On

2015-02-19