Incidental Mutation 'R3552:Kcnh1'
ID268969
Institutional Source Beutler Lab
Gene Symbol Kcnh1
Ensembl Gene ENSMUSG00000058248
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 1
SynonymsKv10.1, Eag1, ether a go-go
MMRRC Submission 040669-MU
Accession Numbers

Genbank: NM_010600, NM_001038607; MGI: 1341721

Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location192190774-192510159 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 192238766 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 118 (N118D)
Ref Sequence ENSEMBL: ENSMUSP00000106468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078470] [ENSMUST00000110844]
Predicted Effect probably damaging
Transcript: ENSMUST00000078470
AA Change: N118D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000077563
Gene: ENSMUSG00000058248
AA Change: N118D

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
Pfam:Ion_trans 217 510 2.2e-40 PFAM
Pfam:Ion_trans_2 422 504 7e-14 PFAM
cNMP 581 699 2.2e-21 SMART
low complexity region 714 726 N/A INTRINSIC
coiled coil region 928 958 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110844
AA Change: N118D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106468
Gene: ENSMUSG00000058248
AA Change: N118D

DomainStartEndE-ValueType
PAS 16 92 2.65e0 SMART
PAC 94 136 3.67e-9 SMART
transmembrane domain 219 241 N/A INTRINSIC
Pfam:Ion_trans 252 471 3.4e-27 PFAM
Pfam:Ion_trans_2 395 477 3.7e-14 PFAM
cNMP 554 672 2.2e-21 SMART
low complexity region 687 699 N/A INTRINSIC
coiled coil region 901 931 N/A INTRINSIC
Meta Mutation Damage Score 0.4184 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit of a voltage-gated non-inactivating delayed rectifier potassium channel. It is activated at the onset of myoblast differentiation. The gene is highly expressed in brain and in myoblasts. Overexpression of the gene may confer a growth advantage to cancer cells and favor tumor cell proliferation. Alternative splicing of this gene results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice exhibit a decreased depressive-like response during tail suspension testing. Mice homozygous for a different knock-out allele exhibit longer latency to move in haloperidol-treated mice and mild hyperactivity. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Kcnh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Kcnh1 APN 1 192418882 missense probably damaging 0.99
IGL01675:Kcnh1 APN 1 192337593 missense probably benign 0.09
IGL01726:Kcnh1 APN 1 192505856 missense possibly damaging 0.47
IGL02006:Kcnh1 APN 1 192191015 missense possibly damaging 0.75
IGL02428:Kcnh1 APN 1 192337543 nonsense probably null
IGL02447:Kcnh1 APN 1 192224916 missense possibly damaging 0.61
IGL02512:Kcnh1 APN 1 192505381 missense possibly damaging 0.64
IGL02748:Kcnh1 APN 1 192221420 missense probably damaging 1.00
IGL02879:Kcnh1 APN 1 192276915 missense probably damaging 1.00
IGL02926:Kcnh1 APN 1 192276900 missense probably damaging 1.00
IGL03058:Kcnh1 APN 1 192434891 missense probably damaging 1.00
IGL03078:Kcnh1 APN 1 192434800 missense probably damaging 1.00
IGL03148:Kcnh1 APN 1 192276999 missense probably damaging 0.99
3-1:Kcnh1 UTSW 1 192337687 nonsense probably null
PIT4449001:Kcnh1 UTSW 1 192418684 missense probably damaging 1.00
R0226:Kcnh1 UTSW 1 192276804 nonsense probably null
R0226:Kcnh1 UTSW 1 192276805 missense probably damaging 1.00
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0240:Kcnh1 UTSW 1 192505340 missense probably benign
R0422:Kcnh1 UTSW 1 192337580 missense probably benign
R0510:Kcnh1 UTSW 1 192418941 splice site probably benign
R0612:Kcnh1 UTSW 1 192277053 missense probably damaging 1.00
R0667:Kcnh1 UTSW 1 192506038 missense probably benign 0.00
R0838:Kcnh1 UTSW 1 192413206 missense probably damaging 0.99
R1303:Kcnh1 UTSW 1 192276702 missense probably damaging 1.00
R1389:Kcnh1 UTSW 1 192505763 missense probably benign 0.00
R1826:Kcnh1 UTSW 1 192413068 missense possibly damaging 0.64
R1997:Kcnh1 UTSW 1 192276935 missense probably damaging 0.99
R2254:Kcnh1 UTSW 1 192505414 intron probably null
R2274:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R2275:Kcnh1 UTSW 1 192337521 missense probably damaging 1.00
R3029:Kcnh1 UTSW 1 192506060 missense probably benign 0.00
R3427:Kcnh1 UTSW 1 192241930 missense probably benign 0.06
R3718:Kcnh1 UTSW 1 192238799 missense probably damaging 1.00
R3760:Kcnh1 UTSW 1 192506024 missense probably damaging 1.00
R4009:Kcnh1 UTSW 1 192277140 missense probably benign
R4027:Kcnh1 UTSW 1 192276699 missense probably benign 0.05
R4453:Kcnh1 UTSW 1 192505517 missense probably damaging 0.97
R4717:Kcnh1 UTSW 1 192276717 missense probably damaging 0.99
R5014:Kcnh1 UTSW 1 192277080 missense probably damaging 0.99
R5040:Kcnh1 UTSW 1 192505475 missense probably benign 0.00
R5110:Kcnh1 UTSW 1 192337747 missense possibly damaging 0.95
R5190:Kcnh1 UTSW 1 192505528 missense probably benign 0.00
R5244:Kcnh1 UTSW 1 192224876 missense probably benign 0.23
R5383:Kcnh1 UTSW 1 192505691 missense probably benign 0.03
R5926:Kcnh1 UTSW 1 192413077 missense probably benign 0.01
R6182:Kcnh1 UTSW 1 192191053 missense probably damaging 0.97
R6516:Kcnh1 UTSW 1 192418781 missense possibly damaging 0.50
R6567:Kcnh1 UTSW 1 192277104 missense probably benign
R6655:Kcnh1 UTSW 1 192413083 missense possibly damaging 0.89
R6715:Kcnh1 UTSW 1 192337641 missense probably benign 0.00
R6823:Kcnh1 UTSW 1 192505289 makesense probably null
R6972:Kcnh1 UTSW 1 192276836 missense probably damaging 1.00
R7199:Kcnh1 UTSW 1 192337605 missense probably benign 0.01
R7219:Kcnh1 UTSW 1 192505637 missense probably benign
R7749:Kcnh1 UTSW 1 192277139 missense probably benign
R7799:Kcnh1 UTSW 1 192434875 missense probably damaging 0.96
R7862:Kcnh1 UTSW 1 192190859 start gained probably benign
R7945:Kcnh1 UTSW 1 192190859 start gained probably benign
R8068:Kcnh1 UTSW 1 192241942 missense probably benign 0.00
Z1176:Kcnh1 UTSW 1 192418737 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACTGTGTAGTCACTCCGTAC -3'
(R):5'- CCTGATCTCTGCACAAGATTGC -3'

Sequencing Primer
(F):5'- AATGTGACGGTGAGATTCTCCCAC -3'
(R):5'- AAGATTGCCTTGGCAACCTCG -3'
Posted On2015-02-19