Incidental Mutation 'R3552:Ssrp1'
ID268970
Institutional Source Beutler Lab
Gene Symbol Ssrp1
Ensembl Gene ENSMUSG00000027067
Gene Namestructure specific recognition protein 1
SynonymsHmgi-rs3, T160, Hmgox, Hmg1-rs1
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location85037234-85047109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 85044392 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 519 (Q519K)
Ref Sequence ENSEMBL: ENSMUSP00000127058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077798] [ENSMUST00000130729] [ENSMUST00000168266]
Predicted Effect probably benign
Transcript: ENSMUST00000077798
AA Change: Q519K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000076971
Gene: ENSMUSG00000027067
AA Change: Q519K

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 1.7e-105 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127069
Predicted Effect probably benign
Transcript: ENSMUST00000130729
AA Change: Q519K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121639
Gene: ENSMUSG00000027067
AA Change: Q519K

DomainStartEndE-ValueType
Pfam:SSrecog 74 285 5.7e-106 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142359
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146530
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151092
Predicted Effect probably benign
Transcript: ENSMUST00000168266
AA Change: Q519K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127058
Gene: ENSMUSG00000027067
AA Change: Q519K

DomainStartEndE-ValueType
Pfam:SSrecog 75 284 8.8e-91 PFAM
Rtt106 338 428 4.76e-41 SMART
low complexity region 469 481 N/A INTRINSIC
low complexity region 486 514 N/A INTRINSIC
low complexity region 521 542 N/A INTRINSIC
HMG 546 616 1.9e-27 SMART
low complexity region 621 691 N/A INTRINSIC
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of a heterodimer that, along with SUPT16H, forms chromatin transcriptional elongation factor FACT. FACT interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT and cisplatin-damaged DNA may be crucial to the anticancer mechanism of cisplatin. This encoded protein contains a high mobility group box which most likely constitutes the structure recognition element for cisplatin-modified DNA. This protein also functions as a co-activator of the transcriptional activator p63. An alternatively spliced transcript variant of this gene has been described, but its full-length nature is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene is lethal resulting in death at some point between implantation and E5.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Ssrp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Ssrp1 APN 2 85041099 splice site probably benign
IGL01935:Ssrp1 APN 2 85046712 makesense probably null
IGL02226:Ssrp1 APN 2 85040361 missense probably damaging 1.00
IGL02793:Ssrp1 APN 2 85040920 missense probably damaging 1.00
IGL02875:Ssrp1 APN 2 85040920 missense probably damaging 1.00
Dickcissel UTSW 2 85041634 missense probably damaging 0.96
Meadowlark UTSW 2 85041106 critical splice acceptor site probably null
PIT4131001:Ssrp1 UTSW 2 85038416 missense probably damaging 1.00
R0313:Ssrp1 UTSW 2 85041554 missense probably damaging 1.00
R0363:Ssrp1 UTSW 2 85040674 missense probably damaging 0.99
R1234:Ssrp1 UTSW 2 85042263 missense probably damaging 1.00
R1643:Ssrp1 UTSW 2 85041185 missense possibly damaging 0.89
R1713:Ssrp1 UTSW 2 85040760 missense probably damaging 0.99
R2049:Ssrp1 UTSW 2 85041427 splice site probably benign
R2113:Ssrp1 UTSW 2 85043006 splice site probably null
R2291:Ssrp1 UTSW 2 85042316 critical splice donor site probably null
R2471:Ssrp1 UTSW 2 85042298 missense possibly damaging 0.95
R2965:Ssrp1 UTSW 2 85041586 missense possibly damaging 0.46
R4060:Ssrp1 UTSW 2 85041634 missense probably damaging 0.96
R4075:Ssrp1 UTSW 2 85045568 missense possibly damaging 0.68
R4131:Ssrp1 UTSW 2 85044447 missense probably null 0.28
R4326:Ssrp1 UTSW 2 85040217 intron probably benign
R4357:Ssrp1 UTSW 2 85041151 missense probably benign 0.22
R4400:Ssrp1 UTSW 2 85037941 missense probably damaging 0.97
R4797:Ssrp1 UTSW 2 85045722 nonsense probably null
R5293:Ssrp1 UTSW 2 85042252 nonsense probably null
R5571:Ssrp1 UTSW 2 85044325 missense probably damaging 0.99
R5592:Ssrp1 UTSW 2 85045519 missense probably benign 0.00
R5743:Ssrp1 UTSW 2 85041168 nonsense probably null
R5991:Ssrp1 UTSW 2 85042296 missense possibly damaging 0.94
R6019:Ssrp1 UTSW 2 85045452 missense probably damaging 1.00
R6133:Ssrp1 UTSW 2 85045339 intron probably benign
R6157:Ssrp1 UTSW 2 85040728 missense probably damaging 0.99
R6225:Ssrp1 UTSW 2 85042814 missense probably benign 0.02
R6551:Ssrp1 UTSW 2 85041106 critical splice acceptor site probably null
R6886:Ssrp1 UTSW 2 85039936 missense probably benign 0.04
R7189:Ssrp1 UTSW 2 85045562 missense probably benign 0.00
R7681:Ssrp1 UTSW 2 85045748 missense probably benign
R7789:Ssrp1 UTSW 2 85041181 missense probably damaging 1.00
X0023:Ssrp1 UTSW 2 85045475 missense probably benign 0.06
Z1088:Ssrp1 UTSW 2 85040653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGTGGTGGAAGCTGTC -3'
(R):5'- TCCTCAAGAAACAAAGTATCCTAGG -3'

Sequencing Primer
(F):5'- CTGAGTCTAAGCCTCGTT -3'
(R):5'- CTTAAGAAAATACCTACTGGGCCGG -3'
Posted On2015-02-19