Incidental Mutation 'R3552:Olfr48'
ID268972
Institutional Source Beutler Lab
Gene Symbol Olfr48
Ensembl Gene ENSMUSG00000075072
Gene Nameolfactory receptor 48
SynonymsIC3, MOR232-5, GA_x6K02T2Q125-51285881-51284976
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89841793-89848205 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 89844343 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 210 (M210R)
Ref Sequence ENSEMBL: ENSMUSP00000150505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099762] [ENSMUST00000111520] [ENSMUST00000213833] [ENSMUST00000214428] [ENSMUST00000215613]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099762
AA Change: M210R

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097350
Gene: ENSMUSG00000075072
AA Change: M210R

DomainStartEndE-ValueType
Pfam:7tm_4 26 299 1e-47 PFAM
Pfam:7tm_1 36 282 8.5e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111520
SMART Domains Protein: ENSMUSP00000107145
Gene: ENSMUSG00000075073

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.1e-5 PFAM
Pfam:7tm_1 39 285 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213833
Predicted Effect possibly damaging
Transcript: ENSMUST00000214428
AA Change: M210R

PolyPhen 2 Score 0.527 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000215613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216674
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Olfr48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01661:Olfr48 APN 2 89844095 missense probably benign 0.00
IGL02184:Olfr48 APN 2 89844385 missense probably damaging 0.98
IGL02408:Olfr48 APN 2 89844971 start codon destroyed probably benign 0.04
IGL02437:Olfr48 APN 2 89844784 missense probably damaging 0.98
IGL02985:Olfr48 APN 2 89844340 missense possibly damaging 0.66
IGL03230:Olfr48 APN 2 89844113 missense probably benign
IGL03393:Olfr48 APN 2 89844569 missense probably benign 0.00
R0482:Olfr48 UTSW 2 89844169 missense probably benign 0.20
R0555:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R1268:Olfr48 UTSW 2 89844154 missense probably damaging 0.98
R1617:Olfr48 UTSW 2 89844254 missense probably benign 0.03
R4172:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4173:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R4174:Olfr48 UTSW 2 89844778 missense probably damaging 1.00
R5540:Olfr48 UTSW 2 89844667 missense probably damaging 1.00
R5909:Olfr48 UTSW 2 89844391 missense possibly damaging 0.89
R5941:Olfr48 UTSW 2 89844515 missense probably benign 0.07
R7425:Olfr48 UTSW 2 89844445 missense probably damaging 0.99
R7445:Olfr48 UTSW 2 89844272 missense probably damaging 0.99
R7660:Olfr48 UTSW 2 89844443 missense probably benign 0.00
R7996:Olfr48 UTSW 2 89844415 missense probably benign 0.28
R8026:Olfr48 UTSW 2 89844929 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CACCGCTTTATCAATAGAGAAGG -3'
(R):5'- TCTGTAAACCGCTGCGCTAC -3'

Sequencing Primer
(F):5'- GTAATTACTGGGCGAAGATACAC -3'
(R):5'- GGTTTTATTCATGCGACCATTCAG -3'
Posted On2015-02-19