Mutagenetix > Incidental Mutation

Incidental Mutation 'R3552:Rbl1'

268976

Institutional Source

Beutler Lab

Gene Symbol

Rbl1

Ensembl Gene

ENSMUSG00000027641

Gene Name

RB transcriptional corepressor like 1

Synonyms

p107

MMRRC Submission

040669-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3552 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

157145893-157204534 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 157195585 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Lysine at position 214 (I214K)

Ref Sequence

ENSEMBL: ENSMUSP00000029170 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029170]

AlphaFold

Q64701

Predicted Effect

probably benign
Transcript: ENSMUST00000029170
AA Change: I214K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000029170
Gene: ENSMUSG00000027641
AA Change: I214K

Domain	Start	End	E-Value	Type
low complexity region	8	28	N/A	INTRINSIC
DUF3452	70	212	5.14e-78	SMART
RB_A	385	578	9.58e-119	SMART
low complexity region	706	719	N/A	INTRINSIC
CYCLIN	800	934	8.68e-6	SMART
Rb_C	947	1063	2.29e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124518

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141296

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154721

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 93.4%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar in sequence and possibly function to the product of the retinoblastoma 1 (RB1) gene. The RB1 gene product is a tumor suppressor protein that appears to be involved in cell cycle regulation, as it is phosphorylated in the S to M phase transition and is dephosphorylated in the G1 phase of the cell cycle. Both the RB1 protein and the product of this gene can form a complex with adenovirus E1A protein and SV40 large T-antigen, with the SV40 large T-antigen binding only to the unphosphorylated form of each protein. In addition, both proteins can inhibit the transcription of cell cycle genes containing E2F binding sites in their promoters. Due to the sequence and biochemical similarities with the RB1 protein, it is thought that the protein encoded by this gene may also be a tumor suppressor. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations are viable and fertile, but may show impaired growth, myeloid hyperplasia in spleen and liver and give rise to cells with a 2X doubling time in vitro. These effects are genetic background dependent. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610009O20Rik	A	G	18: 38,258,365		probably benign	Het
Acaca	T	A	11: 84,261,624	Y866N	probably damaging	Het
Agk	A	G	6: 40,394,681	T371A	probably benign	Het
Akna	T	C	4: 63,398,124	M1V	probably null	Het
Aldh7a1	T	C	18: 56,550,292		probably null	Het
Ankrd26	A	T	6: 118,507,776	L1500H	probably damaging	Het
Atp13a5	T	A	16: 29,310,766	D452V	probably damaging	Het
Bahcc1	C	T	11: 120,276,772	T1333M	possibly damaging	Het
Carmil3	G	T	14: 55,507,402	R1276L	possibly damaging	Het
Ccni	T	C	5: 93,187,761	S173G	probably benign	Het
Chrm2	A	T	6: 36,523,810	I201F	probably damaging	Het
Col16a1	A	G	4: 130,077,041	T618A	probably benign	Het
Dock2	T	C	11: 34,720,960	Y192C	probably benign	Het
Ep400	T	A	5: 110,729,287	E821V	unknown	Het
Esrrg	G	A	1: 188,150,190	V215I	probably benign	Het
Evx1	A	T	6: 52,316,923	S359C	probably damaging	Het
Fcrls	A	G	3: 87,259,410	I92T	possibly damaging	Het
Gal3st1	T	A	11: 3,998,110	F106I	possibly damaging	Het
Gm9944	T	C	4: 144,453,043		probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hrc	G	C	7: 45,336,333	E303Q	possibly damaging	Het
Kcnh1	A	G	1: 192,238,766	N118D	probably damaging	Het
Khdrbs1	A	G	4: 129,720,791	I323T	possibly damaging	Het
Klhdc7b	T	C	15: 89,387,521	Y869H	probably benign	Het
Lrrc4c	T	A	2: 97,629,961	W311R	probably damaging	Het
Megf11	A	G	9: 64,695,463	D862G	possibly damaging	Het
Muc5b	A	G	7: 141,861,335	T2673A	possibly damaging	Het
Muc5b	A	G	7: 141,867,705	S4311G	probably benign	Het
Myo15	C	T	11: 60,509,663	A1767V	possibly damaging	Het
Neo1	T	A	9: 58,893,878	K1140M	probably damaging	Het
Oc90	T	C	15: 65,878,801	Q365R	possibly damaging	Het
Olfr1012	T	C	2: 85,759,893	N161S	possibly damaging	Het
Olfr378	T	C	11: 73,425,852	I44V	probably benign	Het
Olfr48	A	C	2: 89,844,343	M210R	possibly damaging	Het
Oplah	C	T	15: 76,302,094	D734N	possibly damaging	Het
Pbx1	G	A	1: 168,158,793	P411L	possibly damaging	Het
Pcdhga6	G	T	18: 37,708,217	R330L	probably benign	Het
Phox2b	C	A	5: 67,097,656	R150L	probably damaging	Het
Plscr2	A	G	9: 92,290,795	E169G	probably damaging	Het
Ptprn2	A	T	12: 116,888,877	Q518L	probably benign	Het
Ryr1	T	A	7: 29,056,997	Q3464L	probably damaging	Het
Ryr3	T	A	2: 112,751,787	I2854F	probably damaging	Het
Shtn1	T	C	19: 58,975,038	Y615C	probably benign	Het
Sirt5	A	T	13: 43,383,167	N226Y	probably damaging	Het
Slc30a3	G	A	5: 31,095,078		probably benign	Het
Slc5a4b	A	G	10: 76,081,524	V226A	probably damaging	Het
Slf2	C	A	19: 44,934,951	S68*	probably null	Het
Smyd5	G	A	6: 85,442,211	E292K	probably damaging	Het
Spns1	A	G	7: 126,370,371	V512A	possibly damaging	Het
Sry	T	A	Y: 2,663,141	Q173L	unknown	Het
Ssrp1	C	A	2: 85,044,392	Q519K	probably benign	Het
Tgfbr3	T	C	5: 107,139,839	E498G	probably damaging	Het
Tnrc6b	T	G	15: 80,880,247	L650W	probably damaging	Het
Tnxb	A	T	17: 34,718,721	E3861D	probably damaging	Het
Trbc1	G	T	6: 41,539,645		probably benign	Het
Trpm7	T	A	2: 126,826,710		probably benign	Het
Usp39	G	A	6: 72,337,832	T197I	possibly damaging	Het
Vmn1r38	T	C	6: 66,776,493	H213R	possibly damaging	Het
Washc2	A	G	6: 116,220,568	D168G	probably damaging	Het
Washc4	A	G	10: 83,546,856	I45V	probably benign	Het
Zfp352	A	G	4: 90,225,102	E493G	probably benign	Het
Zfp692	C	T	11: 58,309,428	T170I	possibly damaging	Het
Zfp735	C	A	11: 73,711,241	S337*	probably null	Het

Other mutations in Rbl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Rbl1	APN	2	157152892	splice site	probably null
IGL01418:Rbl1	APN	2	157152892	splice site	probably null
IGL01597:Rbl1	APN	2	157195449	splice site	probably benign
IGL01788:Rbl1	APN	2	157163656	missense	probably benign	0.15
IGL02366:Rbl1	APN	2	157174893	missense	probably benign	0.18
IGL02527:Rbl1	APN	2	157194048	missense	probably benign	0.05
IGL02720:Rbl1	APN	2	157199429	missense	possibly damaging	0.94
IGL02828:Rbl1	APN	2	157199464	missense	probably damaging	1.00
IGL02926:Rbl1	APN	2	157167413	missense	probably benign	0.08
IGL02968:Rbl1	APN	2	157177274	missense	probably damaging	1.00
IGL03284:Rbl1	APN	2	157194069	splice site	probably benign
R0042:Rbl1	UTSW	2	157175704	splice site	probably benign
R0089:Rbl1	UTSW	2	157199414	critical splice donor site	probably null
R0173:Rbl1	UTSW	2	157159685	missense	probably benign	0.00
R0464:Rbl1	UTSW	2	157147545	missense	probably damaging	1.00
R1178:Rbl1	UTSW	2	157147655	missense	possibly damaging	0.92
R1296:Rbl1	UTSW	2	157169971	missense	probably benign	0.09
R1430:Rbl1	UTSW	2	157169906	missense	probably benign
R1445:Rbl1	UTSW	2	157193098	missense	probably benign
R1511:Rbl1	UTSW	2	157195634	missense	probably damaging	1.00
R1603:Rbl1	UTSW	2	157175659	missense	possibly damaging	0.75
R1666:Rbl1	UTSW	2	157159734	missense	probably damaging	1.00
R1668:Rbl1	UTSW	2	157159734	missense	probably damaging	1.00
R1680:Rbl1	UTSW	2	157174783	missense	probably damaging	0.97
R1771:Rbl1	UTSW	2	157163534	splice site	probably null
R1833:Rbl1	UTSW	2	157195555	missense	probably damaging	0.98
R1852:Rbl1	UTSW	2	157174903	missense	probably benign	0.01
R2304:Rbl1	UTSW	2	157147631	missense	probably benign	0.02
R3605:Rbl1	UTSW	2	157177233	missense	probably damaging	1.00
R3607:Rbl1	UTSW	2	157177233	missense	probably damaging	1.00
R4160:Rbl1	UTSW	2	157192119	intron	probably benign
R4423:Rbl1	UTSW	2	157168955	intron	probably benign
R4636:Rbl1	UTSW	2	157167420	missense	possibly damaging	0.82
R4780:Rbl1	UTSW	2	157174804	missense	probably benign	0.43
R4789:Rbl1	UTSW	2	157177355	missense	probably benign
R5145:Rbl1	UTSW	2	157175477	intron	probably benign
R5802:Rbl1	UTSW	2	157161433	missense	probably benign	0.23
R5851:Rbl1	UTSW	2	157167325	missense	probably benign	0.00
R6742:Rbl1	UTSW	2	157169998	missense	probably benign	0.19
R6861:Rbl1	UTSW	2	157152967	missense	probably damaging	1.00
R6943:Rbl1	UTSW	2	157188286	missense	probably benign
R7090:Rbl1	UTSW	2	157152900	missense	probably benign	0.02
R7176:Rbl1	UTSW	2	157188325	missense	probably damaging	1.00
R7769:Rbl1	UTSW	2	157191980	missense	probably benign	0.01
R8032:Rbl1	UTSW	2	157187998	nonsense	probably null
R8544:Rbl1	UTSW	2	157193204	missense	probably damaging	1.00
R8552:Rbl1	UTSW	2	157196254	missense	probably damaging	1.00
R8802:Rbl1	UTSW	2	157196153	critical splice donor site	probably null
R8902:Rbl1	UTSW	2	157199500	missense	probably benign	0.00
R9032:Rbl1	UTSW	2	157193153	missense	probably benign	0.02
R9401:Rbl1	UTSW	2	157174822	missense	possibly damaging	0.81
R9420:Rbl1	UTSW	2	157193234	missense	probably damaging	0.99
R9747:Rbl1	UTSW	2	157192046	missense	probably damaging	0.99
X0057:Rbl1	UTSW	2	157188329	nonsense	probably null
X0058:Rbl1	UTSW	2	157174813	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- AATGATGCACGGAGGCTCTTC -3'
(R):5'- GACACTCTTTGTTTACACCAAGGG -3'

Sequencing Primer
(F):5'- GCTTTGAAGTCCGGAGCATG -3'
(R):5'- AGGGTAAGTTACACTCTCCCCG -3'

Posted On

2015-02-19