Incidental Mutation 'R3552:Fcrls'
ID268977
Institutional Source Beutler Lab
Gene Symbol Fcrls
Ensembl Gene ENSMUSG00000015852
Gene NameFc receptor-like S, scavenger receptor
SynonymsIFGP2, Msr2, Fcrh2, moFcRH2sc, 2810439C17Rik
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location87250758-87263738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87259410 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 92 (I92T)
Ref Sequence ENSEMBL: ENSMUSP00000115780 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090986] [ENSMUST00000146512]
Predicted Effect probably benign
Transcript: ENSMUST00000090986
AA Change: I92T

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000088508
Gene: ENSMUSG00000015852
AA Change: I92T

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
IGc2 122 186 2.77e-6 SMART
IGc2 226 291 1.09e-4 SMART
IG 315 396 1e-3 SMART
SR 402 503 7.29e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000146512
AA Change: I92T

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115780
Gene: ENSMUSG00000015852
AA Change: I92T

DomainStartEndE-ValueType
IG 23 106 1.32e-3 SMART
Pfam:Ig_2 111 176 6.1e-6 PFAM
Pfam:Ig_3 111 176 1.4e-4 PFAM
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype PHENOTYPE: Female homozygous mutant mice are larger than controls and show increased mean body weight, total tissue mass, lean body mass and total body fat. Homozygous mutant mice eshow a decreased mean percentage of CD8 cells in the peripheral blood. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Fcrls
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01568:Fcrls APN 3 87256679 missense probably damaging 0.99
IGL01959:Fcrls APN 3 87259632 missense probably damaging 0.97
IGL02409:Fcrls APN 3 87252723 missense probably benign 0.00
IGL02677:Fcrls APN 3 87259387 missense probably benign 0.01
IGL02957:Fcrls APN 3 87262194 missense possibly damaging 0.59
IGL02974:Fcrls APN 3 87257397 missense possibly damaging 0.89
IGL02992:Fcrls APN 3 87259466 missense probably damaging 0.99
R0052:Fcrls UTSW 3 87256778 missense possibly damaging 0.94
R0052:Fcrls UTSW 3 87256778 missense possibly damaging 0.94
R0131:Fcrls UTSW 3 87258959 missense possibly damaging 0.90
R1171:Fcrls UTSW 3 87256860 missense probably benign 0.24
R1319:Fcrls UTSW 3 87262177 critical splice donor site probably null
R1522:Fcrls UTSW 3 87256707 missense possibly damaging 0.64
R1696:Fcrls UTSW 3 87259518 missense possibly damaging 0.95
R1742:Fcrls UTSW 3 87259043 missense possibly damaging 0.76
R2156:Fcrls UTSW 3 87257341 missense probably benign 0.43
R2255:Fcrls UTSW 3 87257348 nonsense probably null
R2257:Fcrls UTSW 3 87259621 missense probably damaging 0.99
R2434:Fcrls UTSW 3 87256698 missense probably damaging 1.00
R2680:Fcrls UTSW 3 87257349 missense probably damaging 0.99
R4866:Fcrls UTSW 3 87263466 missense possibly damaging 0.65
R4883:Fcrls UTSW 3 87259615 missense possibly damaging 0.48
R5654:Fcrls UTSW 3 87257544 missense probably benign
R5771:Fcrls UTSW 3 87263468 missense probably damaging 0.98
R5917:Fcrls UTSW 3 87256787 missense probably damaging 0.99
R6349:Fcrls UTSW 3 87252496 missense probably damaging 0.99
R6562:Fcrls UTSW 3 87257328 missense probably benign
R6954:Fcrls UTSW 3 87263676 critical splice donor site probably benign
R7059:Fcrls UTSW 3 87257340 missense possibly damaging 0.82
R7188:Fcrls UTSW 3 87259523 missense probably benign 0.13
R7201:Fcrls UTSW 3 87252627 missense probably damaging 0.99
R7369:Fcrls UTSW 3 87256701 missense possibly damaging 0.59
R7431:Fcrls UTSW 3 87258926 missense probably damaging 0.99
R7610:Fcrls UTSW 3 87252697 missense probably damaging 1.00
R8018:Fcrls UTSW 3 87259626 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGCCTACAGAGCAAGACAC -3'
(R):5'- CACACCGTTCTTATGAAGGAGAC -3'

Sequencing Primer
(F):5'- TGCCTACAGAGCAAGACACACATAC -3'
(R):5'- GACCAAGTAGTTATAAGCTGCAC -3'
Posted On2015-02-19