Incidental Mutation 'R3552:Ccni'
ID268984
Institutional Source Beutler Lab
Gene Symbol Ccni
Ensembl Gene ENSMUSG00000063015
Gene Namecyclin I
Synonyms
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location93181933-93206495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93187761 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 173 (S173G)
Ref Sequence ENSEMBL: ENSMUSP00000050189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058550] [ENSMUST00000144514] [ENSMUST00000151568] [ENSMUST00000201823]
Predicted Effect probably benign
Transcript: ENSMUST00000058550
AA Change: S173G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000050189
Gene: ENSMUSG00000063015
AA Change: S173G

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123033
Predicted Effect probably benign
Transcript: ENSMUST00000144514
SMART Domains Protein: ENSMUSP00000122434
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
Pfam:Cyclin_N 14 81 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151568
SMART Domains Protein: ENSMUSP00000116224
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201581
Predicted Effect probably benign
Transcript: ENSMUST00000201823
SMART Domains Protein: ENSMUSP00000143972
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
CYCLIN 3 89 7.4e-19 SMART
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Ccni
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02301:Ccni APN 5 93188175 missense possibly damaging 0.77
IGL02545:Ccni APN 5 93187777 missense probably benign 0.01
IGL02865:Ccni APN 5 93183336 missense probably benign 0.04
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0541:Ccni UTSW 5 93187704 missense probably benign 0.00
R0718:Ccni UTSW 5 93202316 missense probably benign 0.00
R0760:Ccni UTSW 5 93183329 missense possibly damaging 0.89
R1656:Ccni UTSW 5 93188074 splice site probably null
R1752:Ccni UTSW 5 93202456 start gained probably benign
R1817:Ccni UTSW 5 93188108 missense possibly damaging 0.89
R3551:Ccni UTSW 5 93187761 missense probably benign 0.05
R3956:Ccni UTSW 5 93183404 missense probably damaging 1.00
R4809:Ccni UTSW 5 93187570 intron probably benign
R4901:Ccni UTSW 5 93183144 missense probably damaging 1.00
R4937:Ccni UTSW 5 93188254 intron probably null
R4975:Ccni UTSW 5 93187694 missense possibly damaging 0.83
R7120:Ccni UTSW 5 93183331 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTGATACCTGTGCTTTCTG -3'
(R):5'- CTCTTCCTATGGATTTAGGGGAAAC -3'

Sequencing Primer
(F):5'- TTCTGAAGCAGTTCAATCGTAAGAGG -3'
(R):5'- TCTGAAAATGTATCAAATCACCACAG -3'
Posted On2015-02-19