Incidental Mutation 'R3552:Chrm2'
ID268987
Institutional Source Beutler Lab
Gene Symbol Chrm2
Ensembl Gene ENSMUSG00000045613
Gene Namecholinergic receptor, muscarinic 2, cardiac
Synonymsmuscarinic acetylcholine receptor 2, M2, Chrm-2, AChR M2
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location36388084-36528414 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36523810 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 201 (I201F)
Ref Sequence ENSEMBL: ENSMUSP00000130874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172278]
Predicted Effect probably damaging
Transcript: ENSMUST00000172278
AA Change: I201F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130874
Gene: ENSMUSG00000045613
AA Change: I201F

DomainStartEndE-ValueType
Pfam:7tm_1 40 440 2.5e-75 PFAM
Meta Mutation Damage Score 0.7447 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The muscarinic cholinergic receptors belong to a larger family of G protein-coupled receptors. The functional diversity of these receptors is defined by the binding of acetylcholine to these receptors and includes cellular responses such as adenylate cyclase inhibition, phosphoinositide degeneration, and potassium channel mediation. Muscarinic receptors influence many effects of acetylcholine in the central and peripheral nervous system. The muscarinic cholinergic receptor 2 is involved in mediation of bradycardia and a decrease in cardiac contractility. Multiple alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have slightly decreased body weight (5%) compared to wild-type animals and are resistant to the tremorogenic, analgesic, and hypothermic responses to oxotremorine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc2 A G 6: 116,220,568 D168G probably damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Chrm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Chrm2 APN 6 36523391 missense probably damaging 1.00
IGL00495:Chrm2 APN 6 36523420 missense possibly damaging 0.61
IGL01011:Chrm2 APN 6 36524438 missense probably benign 0.41
IGL01482:Chrm2 APN 6 36523757 missense possibly damaging 0.95
R0101:Chrm2 UTSW 6 36524495 missense probably damaging 1.00
R0390:Chrm2 UTSW 6 36524111 missense probably benign 0.06
R0539:Chrm2 UTSW 6 36523706 missense possibly damaging 0.69
R0972:Chrm2 UTSW 6 36524466 missense possibly damaging 0.56
R2106:Chrm2 UTSW 6 36523447 missense probably damaging 1.00
R4431:Chrm2 UTSW 6 36524162 missense probably benign
R4910:Chrm2 UTSW 6 36524233 missense probably benign 0.19
R5358:Chrm2 UTSW 6 36523355 missense probably damaging 1.00
R5846:Chrm2 UTSW 6 36523450 missense probably damaging 0.98
R6108:Chrm2 UTSW 6 36523295 missense probably damaging 1.00
R6418:Chrm2 UTSW 6 36523739 missense probably damaging 1.00
R6628:Chrm2 UTSW 6 36523357 missense probably damaging 1.00
R6677:Chrm2 UTSW 6 36524092 missense probably damaging 0.99
R6716:Chrm2 UTSW 6 36524435 missense probably damaging 1.00
R7658:Chrm2 UTSW 6 36523249 missense probably benign 0.00
R8004:Chrm2 UTSW 6 36523286 missense probably damaging 1.00
R8185:Chrm2 UTSW 6 36523889 missense probably benign 0.00
R8277:Chrm2 UTSW 6 36523276 missense probably benign 0.31
R8557:Chrm2 UTSW 6 36524075 missense probably benign
Z1177:Chrm2 UTSW 6 36524607 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGATGATTGCAGCTGC -3'
(R):5'- ACGCAGTTTTCAGTCCCACC -3'

Sequencing Primer
(F):5'- CAGCTGCGTGGGTTCTTTCC -3'
(R):5'- GGAGCCTTGCCATTCTGGATC -3'
Posted On2015-02-19