Incidental Mutation 'R3552:Washc2'
ID268992
Institutional Source Beutler Lab
Gene Symbol Washc2
Ensembl Gene ENSMUSG00000024104
Gene NameWASH complex subunit 2`
SynonymsFam21, D6Wsu116e, C530005J20Rik
MMRRC Submission 040669-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3552 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location116208038-116262686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 116220568 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 168 (D168G)
Ref Sequence ENSEMBL: ENSMUSP00000144703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036759] [ENSMUST00000203286] [ENSMUST00000203523] [ENSMUST00000203928] [ENSMUST00000204283] [ENSMUST00000204476]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036759
AA Change: D254G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000038983
Gene: ENSMUSG00000024104
AA Change: D254G

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Pfam:CAP-ZIP_m 939 1074 4.3e-58 PFAM
low complexity region 1268 1282 N/A INTRINSIC
low complexity region 1297 1317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203161
Predicted Effect probably benign
Transcript: ENSMUST00000203286
Predicted Effect probably benign
Transcript: ENSMUST00000203523
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203802
Predicted Effect probably benign
Transcript: ENSMUST00000203928
Predicted Effect probably damaging
Transcript: ENSMUST00000204283
AA Change: D168G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144703
Gene: ENSMUSG00000024104
AA Change: D168G

DomainStartEndE-ValueType
coiled coil region 9 43 N/A INTRINSIC
low complexity region 110 127 N/A INTRINSIC
low complexity region 130 152 N/A INTRINSIC
low complexity region 176 190 N/A INTRINSIC
low complexity region 357 369 N/A INTRINSIC
low complexity region 445 475 N/A INTRINSIC
low complexity region 574 582 N/A INTRINSIC
low complexity region 715 724 N/A INTRINSIC
Pfam:CAP-ZIP_m 853 988 2.8e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204476
AA Change: D254G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144982
Gene: ENSMUSG00000024104
AA Change: D254G

DomainStartEndE-ValueType
coiled coil region 95 129 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
low complexity region 262 276 N/A INTRINSIC
low complexity region 443 455 N/A INTRINSIC
low complexity region 531 561 N/A INTRINSIC
low complexity region 660 668 N/A INTRINSIC
low complexity region 801 810 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik A G 18: 38,258,365 probably benign Het
Acaca T A 11: 84,261,624 Y866N probably damaging Het
Agk A G 6: 40,394,681 T371A probably benign Het
Akna T C 4: 63,398,124 M1V probably null Het
Aldh7a1 T C 18: 56,550,292 probably null Het
Ankrd26 A T 6: 118,507,776 L1500H probably damaging Het
Atp13a5 T A 16: 29,310,766 D452V probably damaging Het
Bahcc1 C T 11: 120,276,772 T1333M possibly damaging Het
Carmil3 G T 14: 55,507,402 R1276L possibly damaging Het
Ccni T C 5: 93,187,761 S173G probably benign Het
Chrm2 A T 6: 36,523,810 I201F probably damaging Het
Col16a1 A G 4: 130,077,041 T618A probably benign Het
Dock2 T C 11: 34,720,960 Y192C probably benign Het
Ep400 T A 5: 110,729,287 E821V unknown Het
Esrrg G A 1: 188,150,190 V215I probably benign Het
Evx1 A T 6: 52,316,923 S359C probably damaging Het
Fcrls A G 3: 87,259,410 I92T possibly damaging Het
Gal3st1 T A 11: 3,998,110 F106I possibly damaging Het
Gm9944 T C 4: 144,453,043 probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hrc G C 7: 45,336,333 E303Q possibly damaging Het
Kcnh1 A G 1: 192,238,766 N118D probably damaging Het
Khdrbs1 A G 4: 129,720,791 I323T possibly damaging Het
Klhdc7b T C 15: 89,387,521 Y869H probably benign Het
Lrrc4c T A 2: 97,629,961 W311R probably damaging Het
Megf11 A G 9: 64,695,463 D862G possibly damaging Het
Muc5b A G 7: 141,861,335 T2673A possibly damaging Het
Muc5b A G 7: 141,867,705 S4311G probably benign Het
Myo15 C T 11: 60,509,663 A1767V possibly damaging Het
Neo1 T A 9: 58,893,878 K1140M probably damaging Het
Oc90 T C 15: 65,878,801 Q365R possibly damaging Het
Olfr1012 T C 2: 85,759,893 N161S possibly damaging Het
Olfr378 T C 11: 73,425,852 I44V probably benign Het
Olfr48 A C 2: 89,844,343 M210R possibly damaging Het
Oplah C T 15: 76,302,094 D734N possibly damaging Het
Pbx1 G A 1: 168,158,793 P411L possibly damaging Het
Pcdhga6 G T 18: 37,708,217 R330L probably benign Het
Phox2b C A 5: 67,097,656 R150L probably damaging Het
Plscr2 A G 9: 92,290,795 E169G probably damaging Het
Ptprn2 A T 12: 116,888,877 Q518L probably benign Het
Rbl1 A T 2: 157,195,585 I214K probably benign Het
Ryr1 T A 7: 29,056,997 Q3464L probably damaging Het
Ryr3 T A 2: 112,751,787 I2854F probably damaging Het
Shtn1 T C 19: 58,975,038 Y615C probably benign Het
Sirt5 A T 13: 43,383,167 N226Y probably damaging Het
Slc30a3 G A 5: 31,095,078 probably benign Het
Slc5a4b A G 10: 76,081,524 V226A probably damaging Het
Slf2 C A 19: 44,934,951 S68* probably null Het
Smyd5 G A 6: 85,442,211 E292K probably damaging Het
Spns1 A G 7: 126,370,371 V512A possibly damaging Het
Sry T A Y: 2,663,141 Q173L unknown Het
Ssrp1 C A 2: 85,044,392 Q519K probably benign Het
Tgfbr3 T C 5: 107,139,839 E498G probably damaging Het
Tnrc6b T G 15: 80,880,247 L650W probably damaging Het
Tnxb A T 17: 34,718,721 E3861D probably damaging Het
Trbc1 G T 6: 41,539,645 probably benign Het
Trpm7 T A 2: 126,826,710 probably benign Het
Usp39 G A 6: 72,337,832 T197I possibly damaging Het
Vmn1r38 T C 6: 66,776,493 H213R possibly damaging Het
Washc4 A G 10: 83,546,856 I45V probably benign Het
Zfp352 A G 4: 90,225,102 E493G probably benign Het
Zfp692 C T 11: 58,309,428 T170I possibly damaging Het
Zfp735 C A 11: 73,711,241 S337* probably null Het
Other mutations in Washc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Washc2 APN 6 116256676 missense probably benign
IGL00552:Washc2 APN 6 116256824 missense possibly damaging 0.85
IGL01397:Washc2 APN 6 116247998 missense probably benign 0.44
IGL01668:Washc2 APN 6 116262338 missense probably damaging 1.00
IGL01982:Washc2 APN 6 116236189 missense probably benign 0.22
IGL02022:Washc2 APN 6 116259165 missense probably benign 0.22
IGL02150:Washc2 APN 6 116231632 splice site probably benign
IGL02224:Washc2 APN 6 116220569 missense possibly damaging 0.70
IGL02553:Washc2 APN 6 116241610 missense probably damaging 0.98
IGL02555:Washc2 APN 6 116209100 missense probably damaging 1.00
IGL02612:Washc2 APN 6 116220616 missense possibly damaging 0.90
IGL02622:Washc2 APN 6 116214018 splice site probably benign
IGL02900:Washc2 APN 6 116227474 missense probably damaging 1.00
IGL03263:Washc2 APN 6 116238123 splice site probably benign
fading UTSW 6 116254153 missense probably damaging 1.00
R0218:Washc2 UTSW 6 116248046 nonsense probably null
R0285:Washc2 UTSW 6 116221839 missense probably damaging 1.00
R0346:Washc2 UTSW 6 116220523 splice site probably benign
R0677:Washc2 UTSW 6 116244616 missense probably damaging 1.00
R0919:Washc2 UTSW 6 116208264 missense probably damaging 1.00
R1144:Washc2 UTSW 6 116224534 missense probably damaging 1.00
R1666:Washc2 UTSW 6 116223254 critical splice donor site probably null
R1687:Washc2 UTSW 6 116256712 missense probably benign 0.06
R1702:Washc2 UTSW 6 116229306 missense probably damaging 0.99
R1740:Washc2 UTSW 6 116231632 splice site probably benign
R1952:Washc2 UTSW 6 116255091 missense possibly damaging 0.92
R1964:Washc2 UTSW 6 116208987 missense probably damaging 0.99
R2039:Washc2 UTSW 6 116224439 missense probably damaging 0.99
R3084:Washc2 UTSW 6 116227493 missense probably benign 0.00
R3790:Washc2 UTSW 6 116247972 splice site probably benign
R3949:Washc2 UTSW 6 116208204 utr 5 prime probably benign
R4089:Washc2 UTSW 6 116256292 splice site probably null
R4133:Washc2 UTSW 6 116258930 missense probably damaging 0.99
R4258:Washc2 UTSW 6 116208241 missense probably damaging 1.00
R4510:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4511:Washc2 UTSW 6 116220556 missense probably damaging 1.00
R4613:Washc2 UTSW 6 116229269 missense probably damaging 1.00
R4614:Washc2 UTSW 6 116238174 missense possibly damaging 0.83
R4794:Washc2 UTSW 6 116258649 missense probably benign 0.03
R5224:Washc2 UTSW 6 116209004 makesense probably null
R5367:Washc2 UTSW 6 116259150 missense probably damaging 1.00
R5602:Washc2 UTSW 6 116248095 missense possibly damaging 0.73
R6013:Washc2 UTSW 6 116254153 missense probably damaging 1.00
R6075:Washc2 UTSW 6 116227366 missense probably benign 0.02
R6086:Washc2 UTSW 6 116256216 splice site probably null
R6344:Washc2 UTSW 6 116258758 missense probably benign 0.08
R6593:Washc2 UTSW 6 116259249 missense probably damaging 1.00
R7048:Washc2 UTSW 6 116220583 missense possibly damaging 0.96
R7062:Washc2 UTSW 6 116219988 missense possibly damaging 0.72
R7241:Washc2 UTSW 6 116208207 start codon destroyed probably null 0.01
R7283:Washc2 UTSW 6 116227418 missense probably damaging 0.99
R7681:Washc2 UTSW 6 116260657 missense probably damaging 0.99
R7810:Washc2 UTSW 6 116259059 missense probably benign
X0018:Washc2 UTSW 6 116208258 missense probably null 0.96
Predicted Primers PCR Primer
(F):5'- TGGTATTTGTATGCCAAGTCTCC -3'
(R):5'- TTGAGGAAGTCATCTACCGTTTACC -3'

Sequencing Primer
(F):5'- GTATGCCAAGTCTCCTAAAAATGAC -3'
(R):5'- GGAAGTCATCTACCGTTTACCTCTGG -3'
Posted On2015-02-19